Labshake search
Citations for Bio-Rad :
2001 - 2050 of 4225 citations for Rat Alpha ketoglutarate dependent dioxygenase FTO FTO ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was reverse-transcribed using an iScript™ cDNA Synthesis Kit (Bio-Rad). For real-time PCR determinations ...
-
bioRxiv - Molecular Biology 2023Quote: ... treated and converted to cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad). Primers for LmTERT (target ...
-
bioRxiv - Cell Biology 2023Quote: ... 500 ng RNA was reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, USA). One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a CFX 384 Real Time PCR System (BioRad ...
-
bioRxiv - Bioengineering 2023Quote: ... and immediately converted to complementary DNA (cDNA) using an iScript cDNA Synthesis Kit (BioRad). qPCR was conducted on a 96-well plate using 30 ng of cDNA with TaqMan Fast Advanced Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... Protein concentrations were determined using a standard Bradford Colorimetric Assay kit (Bio-Rad, 5000116). Proteins were separated by SDS-PAGE and transferred to 0.45µm nitrocellulose membranes ...
-
bioRxiv - Molecular Biology 2023Quote: ... were collected and protein concentration was determined using DC Protein assay kit (Bio-Rad).
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μg was reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time quantitative RT– PCR was performed on a LightCycler 2.0 apparatus (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were determined using the Bradford Protein Assay kit (Bio-Rad, Hercules, CA). Proteins were separated by electrophoresis on 4-20% SDS-PAGE gels (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... iTaq™ Universal SYBR® Green Supermix kit (cat. #1725124, Bio-Rad Laboratories Ltd.) was used according to the manufacturer’s recommendation with cDNA (diluted 1:10∼20 ...
-
bioRxiv - Physiology 2023Quote: ... supernatant was retained and protein quantified with the DC Protein assay kit II (Biorad). Proteins samples (1.5µg and 3µg of proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription was performed with iScript™ Advanced cDNA Synthesis Kit (BioRad, NSW, Australia) and the PCR was performed with PrimePCR SYBR® Green Assays (BioRad ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by cDNA preparation using the BioRad iScript cDNA Synthesis kit (BioRad; Cat #:1708891). cDNA was subsequently purified with AMPure XP beads (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... Protein concentration was measured using the DC Protein Assay Kit II (5000112, Bio-Rad) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration was measured using a RC-DC kit (Biorad Lab., Hercules, CA, USA) according to the manufacturing protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... 200ng of totalRNA sample was reverse transcribed with iScript cDNA synthesis kit (Bio-Rad) and quantitative PCR (q-PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was reverse-transcribed into cDNA using iScript cDNA Synthesis Kit (Bio-Rad; 1708891). GoTaq quantitative PCR (qPCR ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA (1 μg) was reverse transcribed using iScript™ cDNA Synthesis Kit (Bio-Rad), and PCR was performed using Q5® High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Systems Biology 2024Quote: ... and the protein was quantified using the BCA Protein Assay Kit (Bio-Rad, USA). Protein digestion was performed with trypsin following the filter-aided sample preparation (FASP ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad; Hercules, CA, USA), according to the manufacturer’s protocol using 1 µg total RNA in 20-µL reactions.
-
bioRxiv - Microbiology 2024Quote: ... treated with Turbo DNase and converted to cDNA using iScript cDNA synthesis kit (BioRad). Gene expression was quantified using iTaq Universal SYBR Green (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... whose concentrations were measured using the DC Protein Assay Kit (Lowry method, BioRad, 5000116), following the instructions provided by the manufacturer.
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were revealed using an enhanced chemiluminescence kit (1705061 Bio-Rad, Hercules, California, USA) and the imaging system LAS-4000 mini (GE HealthCare Technologies Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was retrotranscribed into cDNA using the iScript™ cDNA synthesis kit (BioRad, 1708891). PCR was performed using Phusion Universal qPCR Kit (Life Tech ...
-
bioRxiv - Developmental Biology 2024Quote: ... Conversion into cDNA was performed using reverse transcription (iScript cDNA Synthesis Kit; Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was prepared by following manufacture’s instruction (iScript select cDNA synthesis kit, BioRad). The GNL primers (GTTTGGAGA CAATGATGGCGT/TCCCGTTCCAGCGAGAGTAAC ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was reverse transcribed to cDNA using the iScript Advanced cDNA kit (Biorad) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein concentrations were determined by Bradford protein assay reagent kit (BIO-RAD, Hercules, CA). Visible GFP bands in the Comassie Blue Stained protein gels were quantified with 1D-Multi lane densitometry (Alpha Innotech Alphaimager 2200 ...
-
bioRxiv - Cell Biology 2024Quote: ... and then transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA synthesis was then performed using reverse transcription kits (Bio-Rad Laboratories, Hercules, CA). qPCR was carried out with TaqMan® probe/primers (Applied Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis kit (Bio-Rad, #170-8891). qRT-PCR was performed in triplicate on a CFX384 Real Time System C1000 Thermal Cycler (Bio-rad ...
-
bioRxiv - Neuroscience 2024Quote: ... The complementary DNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, #1708891, USA), according to the manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was generated from 1ug RNA using iScript reverse transcription kit (Bio-Rad, #1708891) and diluted 1:3 in water ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA was reverse transcribed into cDNA using an iScript cDNA synthesis kit (Bio-Rad) following the manufacturer’s instruction.
-
bioRxiv - Genetics 2020Quote: ... quantitated and 1 μg of RNA reverse transcribed into cDNA using iScript kit (Bio-Rad). Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA reverse transcription was done using the iScript cDNA synthesis kit (Bio-Rad Laboratories, 1708891) according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 µL cDNA was used to perform qPCR using SsoAdvanced SYBR Green supermix kit (BioRad) on a CFX96 machine (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was generated from 1 μg mRNA using iScript reverse transcription kit (Bio-Rad, #1708891) and diluted 1:3 in water ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was reverse transcribed to cDNA using iScript cDNA Synthesis Kit (Bio-Rad, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... RNA was reverse-transcribed using an iScript cDNA synthesis kit (Bio-Rad, Des Plaines, IL). Assay of RNA via quantitative PCR [qPCR] was performed with iTaq universal SYBR green supermix (Bio-Rad) ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was converted to cDNA using the iScript cDNA synthesis kit (1708891, Bio-Rad). We performed transcript-specific PCRs using the following primers and conditions ...
-
bioRxiv - Genetics 2020Quote: ... We synthesized cDNA using Bio-Rad iScript Reverse Transcription Supermix kit (Bio-Rad, 170-8891). We amplified hmx1 sequence from the cDNA using Phusion High-Fidelity DNA Polymerase (M0530L ...
-
bioRxiv - Microbiology 2021Quote: ... One microgram from each sample was reverse transcribed using an iScript cDNA Synthesis Kit (BioRad). RT-qPCR was then performed using gene-specific primers (Table S1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two µg of RNA was reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad) to synthesize cDNA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA integrity and concentration were determined using Experion RNA StdSens analysis kit (BioRad, Hercules, USA). Total RNA was DNase treated (TurboDNase ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized using the iScript gDNA Clear cDNA Synthesis kit (1725035, Bio-Rad, USA) and a Bio-Rad C1000 Touch ThermoCycler (Bio-Rad) ...
-
bioRxiv - Immunology 2020Quote: ... RNA (700 ng) was reverse transcribed using iScript cDNA synthesis kit (Biorad, Hercules, CA, USA). The cDNA obtained was used for subsequent real-time quantitative qPCR reactions (CFX96 Thermal Cycler ...