Labshake search
Citations for Bio-Rad :
1851 - 1900 of 4225 citations for Rat Alpha ketoglutarate dependent dioxygenase FTO FTO ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... DNase-treated RNA was converted to cDNA using the iScript cDNA Synthesis Kit (BioRad). One µl of 1:5 cDNA sample dilutions were used for qPCR reactions ...
-
bioRxiv - Bioengineering 2019Quote: ... Membranes were developed by chemiluminiscence using the Clarity Western ECL Substrate kit (Bio-Rad) and images were acquired using a ChemiDoc Touch system (Bio-Rad).
-
bioRxiv - Genomics 2019Quote: ... refer to the SureCell ATAC-Seq Library Prep Kit User Guide (17004620, Bio-Rad). Tagmented cells or nuclei were loaded onto a ddSEQ Single-Cell Isolator (12004336 ...
-
bioRxiv - Developmental Biology 2019Quote: ... cDNA synthesis was first performed using the iScript™ cDNA Synthesis Kit (Bio-Rad) and 500 ng of isolated RNA per reaction ...
-
bioRxiv - Plant Biology 2019Quote: ... 1 µg of RNA was reverse-transcribed using the IScript cDNA synthesis kit (BioRad) or Superscript IV RT (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... for RNA-seq validation and iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) for knockdown experiments ...
-
bioRxiv - Physiology 2020Quote: ... cDNA synthesis were then carried out with the iScript cDNA Synthesis Kit (Bio-Rad). Quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2020Quote: ... T7-tagged templates were generated with the iProof High-Fidelity PCR Kit (Bio-Rad) using sequences cloned into plasmids pIB (LacZ) ...
-
bioRxiv - Genetics 2019Quote: ... Protein concentrations were determined using the DCM Protein Assay Kit BioRad (#500-0116, Biorad).
-
bioRxiv - Immunology 2020Quote: ... RNA was converted to cDNA using the iScript cDNA synthesis kit (BioRad, CA, USA). Gene expression levels were determined using a TaqMan expression assay ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA samples were reverse transcribed into cDNA using the iScript cDNA synthesis kit (BioRad). Primers were designed to result in a product spanning exons 4-6 of cdipt ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA samples were subjected to reverse transcription using iScript™ cDNA Synthesis Kit (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA synthesis was achieved using iScript™ Advanced cDNA Synthesis Kit (Bio-Rad), according to the manufacturer’s instruction ...
-
bioRxiv - Pathology 2020Quote: ... RNA was then used for cDNA synthesis using the iScript cDNA synthesis kit (BioRad). cDNA templates were used for real-time quantitative PCR with KAPA SYBR Fast qPCR kit (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was retrotranscribed into cDNA using the iScript™ cDNA synthesis kit (BioRad, 1708891). End-point PCR was performed using Phusion Universal qPCR Kit (Life Tech ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized from total RNA using iScript Advanced cDNA Synthesis Kit (Bio-Rad). Genomic DNA and cDNA were then genotyped for rs17779352 using a custom Taqman genotyping assay for rs17779352 (ANCE9Z2 ...
-
bioRxiv - Pathology 2020Quote: ... The blots were developed using ECL immunochemical detection kit (Bio-Rad, Richmond, CA, USA) and densitometric analysis was conducted to quantify the Western blot immunoreactivity with a scanner and ImageQuant software (Amersham Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was purified with an Arum Total RNA mini kit (Bio-rad #732-6820). Reverse transcription was carried out using the iScript Advanced cDNA Synthesis kit (Bio-rad #1725037) ...
-
bioRxiv - Microbiology 2020Quote: ... Signals were visualised using the ECL kit (Clarity Western ECL, Bio-Rad, Hercules, California) as suggested by the manufacturer.
-
bioRxiv - Microbiology 2020Quote: ... the protein signals were detected using the ECL detection kit (Bio-Rad, California, USA). Blots were analyzed using Quantity One software (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: Luminex profiles utilized the Human Inflammation Panel 1 37-plex assay kit (Bio-Rad) per the manufacturer’s protocol using the laboratory multianalyte profiling system (MAGPIX ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 mg total) was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad) and diluted to 100 μl in ddH20 for subsequent qPCR ...
-
A family of contact-dependent nuclease effectors contain an exchangeable, species-identifying domainbioRxiv - Microbiology 2020Quote: ... and finally developed using Immun-Star HRP substrate kit (Bio-Rad Laboratories, Hercules, CA). Blots were visualized using a Chemidoc (Bio-Rad Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized from total RNA using iScript Advanced cDNA Synthesis Kit (Bio-Rad). Genomic DNA and cDNA were then genotyped for rs398206 using custom Taqman genotyping probe set (ANRWEYM ...
-
bioRxiv - Physiology 2020Quote: ... 500ng mRNA was used for cDNA synthesis using the iScript kit (Bio-Rad, 1708891). Quantitative PCR was performed in triplicate 25 μL reactions using 2X SYBR Green SuperMix (PerfeCTa ...
-
bioRxiv - Developmental Biology 2019Quote: ... and converted into 100-500ng cDNA using the iScript cDNA synthesis kit (Bio-Rad). RT-PCR was performed with 10–100 ng of cDNA template in a 25 μl total reaction volume (12.5 μl iQ SYBR Green Supermix (2× ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Finally ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription was carried out using an iScript™ cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed using the iQ™ SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was visualized using the ECL Western Blotting Detection Kit (Bio-Rad, USA).
-
bioRxiv - Developmental Biology 2019Quote: ... Complementary DNA was created by reverse transcription using an iScript cDNA kit (Bio-Rad) following manufacturer’s instructions and using 500 ng of input RNA for each sample ...
-
bioRxiv - Developmental Biology 2019Quote: ... Each analysis was performed in triplicate using iQ SYBR Green Supermix kit (Bio-Rad). Samples were standardized to a RP49 control ...
-
bioRxiv - Physiology 2019Quote: ... mRNA was reverse transcribed with iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA) and quantitative RT-PCR was performed using Ssofast EvaGreen Supermix (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... then we performed reverse transcription using the iScriptTM cDNA Synthesis Kit (BioRad, Hercules, CA).
-
bioRxiv - Neuroscience 2019Quote: ... The RNA was converted into cDNA using the iScriptTM cDNA synthesis kit (Bio-Rad) following manufacturer's instructions ...
-
bioRxiv - Physiology 2019Quote: ... cDNA was synthesized using the iScript Advanced cDNA Synthesis Kit (Bio-Rad, Hercules, CA), then preamplified using SsoAdvanced PreAmp Supermix (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and the commercially available iScript™ cDNA synthesis kit (Bio-Rad, Gladesville, NSW, Australia) in the presence of random hexamers and oligo(dT)s ...
-
bioRxiv - Immunology 2019Quote: ... Two micrograms of total RNA were reverse transcribed using iScript cDNA synthesis kit (BioRad) in a total volume of 20 μl ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules CA) according to manufacturer’s recommendations using 1.0 µg of purified total RNA.
-
bioRxiv - Genomics 2021Quote: ... refer to the SureCell ATAC-Seq Library Prep Kit User Guide (17004620, Bio-Rad). Tagmented cells were loaded onto a ddSEQ Single-Cell Isolator (12004336 ...
-
bioRxiv - Microbiology 2021Quote: ... The autoradiography signals were visualized using ECL advance Western blotting detection kit (BioRad, USA).
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using the iScript™ Reverse Transcription Supermix kit (Bio-Rad, #1708841).
-
bioRxiv - Physiology 2021Quote: ... Protein concentration in the lysates was estimated using Dc protein assay kit (Bio-Rad). The lysates (30 μg ...
-
bioRxiv - Neuroscience 2020Quote: ... and retro-transcribed into cDNA by iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad, Hercules, CA, USA) and primers listed in Table 1 ...
-
bioRxiv - Plant Biology 2020Quote: ... Total protein of the samples was quantified using a Protein DC kit (Bio-Rad). β-Mercaptoethanol and loading dye was added to 125 µg of the samples ...
-
bioRxiv - Immunology 2020Quote: Reverse transcription of RNA was performed utilizing iScript cDNA Synthesis Kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized with iScript™ cDNA Synthesis Kit (#170-8891 from Bio-Rad). qPCR was performed using KAPA SYBR® Fast and primers for ITGB1 (5’AGATCCGAAGTTTCAAGGGC3’ and 5’GAACCATGACCTCGTTGTTC3’) ...
-
bioRxiv - Developmental Biology 2021Quote: ... the RNA was reverse transcribed (RT) using the iScript cDNA synthesis kit (Bio-Rad) in a final volume of 10 μl ...
-
bioRxiv - Neuroscience 2021Quote: ... Retrotranscription (RT) reactions were performed using the iScript cDNA Synthesis kit (Biorad PN170-8891) following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Purified sfGFP was measured using a Quick Start Bradford Kit (BioRad, Hercules, CA, USA) in biological triplicate and technical triplicate.