Labshake search
Citations for Bio-Rad :
1951 - 2000 of 6194 citations for Progesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... 5 µL of purified (mutant) protein sample was mixed with 1.67 µL of 4X Laemmli loading buffer (Bio-Rad 1610747), then 5 µL was loaded onto an SDS-PAGE gel (Either 12% isocratic (Bio-Rad 4561046 ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 µg of protein lysate was heat-denatured at 95°C for 5 minutes in Laemmli sample buffer (Bio-Rad), and then separated using a 4 to 12% Bis-Tris polyacrylamide gel (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: ... membranes were rinsed three-times in TBS/0.2% Tween for 10min and incubated for 1h with goat secondary anti-rabbit IgG linked to peroxidase (dilution 1:5 000, Biorad) in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Microbiology 2020Quote: ... the membrane was washed four times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (1:2000 dilution of BioRad affinity purified goat α-rabbit or goat α-mouse IgG conjugated to alkaline phosphatase ...
-
bioRxiv - Microbiology 2021Quote: Isothermal assembly reaction buffer (5×) (500 mM Tris-HCl [pH 7.5], 50 mM MgCl2, 50 mM dithiothreitol [DTT] [Bio-Rad] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mean fluorescence intensity was measured to calculate final concentration in pg/mL using Bioplex200 and Bioplex Manager 5 software (Biorad).
-
bioRxiv - Cancer Biology 2020Quote: ... Target sequences in cDNA library were amplified in 10 μl qPCR reaction (5 μl SYBR Green supermix (Bio-Rad #1725121), 0.675 μl 2.5 μM primer mix and 0.45 μl diluted cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were transferred to PVDF membranes and blocked in TBS with 0.1% Tween-20 (TBST) and 5% Blotting Grade Buffer (BGB, Bio-Rad). The anti-RBM20 rabbit polyclonal primary antibody (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were loaded onto Mini-PROTEAN TGX Pre-cast Stain-Free gels (5-15%, Bio-Rad Laboratories, Hercules, CA, USA) and total protein was visualised post-transfer to PVDF membranes on ChemiDoc Touch Imaging System ...
-
bioRxiv - Biophysics 2021Quote: ... 10 mM borate pH 10 was prepared at 5 μM and loaded onto a 4-20% Mini-Protean TGX pre-cast gel (BioRad). 10 μL of each folding sample was subsequently loaded onto the same gel ...
-
bioRxiv - Biochemistry 2022Quote: ... by loading samples onto a 0.5X TBE 5% polyacrylamide gel prepared for a Mini-PROTEAN Tetra Vertical Electrophoresis Cell (Bio-Rad) using ProtoGel acrylamide (National Diagnostics) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The beads were washed 5 times and denatured with 4x Laemmli sample buffer (Cat: 161-0747, BioRad, Hercules, CA, USA) at 100 C for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Nuclear and cytosolic fractions of iPSCs-differentiated cells were acquired using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific #78833 ...
-
bioRxiv - Microbiology 2022Quote: ... 5 ng of each sample was loaded into a well of a 10% Mini-PROTEAN TGX Precast Gel (Bio-Rad). Gels were transferred to PVDF membranes (Merck KGaA ...
-
bioRxiv - Genomics 2022Quote: Slot blot was performed using 1.5 ng of gDNA that was denatured in 400 mM NaOH/10 mM EDTA and blotted onto nitrocellulose membrane (BioRad) in duplicate for dsDNA and 5mC DNA using a slot blot apparatus (BioRad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were eluted by heating the beads at 95°C for 5 min in Laemmli Sample Buffer (1610747, Bio-Rad) with 50 mM DTT followed by magnetic separation ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then washed with IP lysis buffer three time and boiled in 25 ul of 2X SDS-loading buffer for 5 minutes and loaded into 4-15% polyacrylamide gels (BioRad).
-
bioRxiv - Cell Biology 2019Quote: ... were boiled for 5 min and then loaded into 10% Mini-Protean TGX (Tris-Glycine eXtended) Stain-Free precast Gels (Biorad). Electrophoresis was performed in a buffer containing 25 mM Tris ...
-
bioRxiv - Genomics 2020Quote: ... Membranes were washed using tris-based saline buffer solutions with 0.1% tween-20 (TBST) and blocking solutions were prepared using 5% w/v western-blot grade dry milk powder (Biorad). Membranes were blocked with blocking buffer for 1 hour and washed between incubations for 5-10 mins (3x) ...
-
bioRxiv - Microbiology 2021Quote: ... The protein from the 5% of beads was eluted by boiling the beads in Laemmli sample buffer supplemented with BME (BioRad) and 2 mM biotin at 90°C for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl; BioRad) and transferred onto Immun-Blot PVDF 0.2 µm (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 ng of cDNA was analyzed with isoform-specific droplet digital PCR assays and ddPCR Supermix for probes (Bio-Rad). Primers and probes (Integrated DNA Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... The PCR reaction was carried out in 10 μl volume with 5 μl of 2X iTaq Universal Sybergreen Supermix (BioRad), 500 nM of forward and reverse primers (for promoter ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lysates were then denatured in 2X Laemmli at 95°C for 5 minutes and run in Mini-PROTEAN Precast Gels (BioRad) and transferred onto membranes using Trans-Blot Turbo ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 57 DNA from whole mosquitoes was extracted using 200 µL of 5% Chelex 100 Resin (Bio-Rad Laboratories, Hercules, CA) and 3 μL of Proteinase K (20 mg/ mL ...
-
bioRxiv - Molecular Biology 2019Quote: ... the HRP substrate (GE Helathcare) was applied to the membrane for 5 minutes and the chemiluminescence was read on Chemidoc (Biorad).
-
bioRxiv - Genetics 2020Quote: ... The membrane was washes in TBS-T three times and incubated 5 min with Clarity Western ECL Substrate (#1705061, Biorad) in order to detect proteins immunoblotted signals at Alliance LD4 (UVItec Cambridge ...
-
bioRxiv - Molecular Biology 2019Quote: ... The slide was washed in TBS-T (4x 5 min) and visualized using SuperSignal West Pico chemiluminescent substrate (Pierce) and a ChemiDoc MP System (BioRad). Signal intensity normalization was performed using Array Analyze Software (Active Motif).
-
bioRxiv - Biochemistry 2020Quote: ... The samples were heated at 95°C for 5 min and separated on a 12% Bis-Tris SDS-PAGE gel (Biorad).
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 or 10 μL of the supernatant were resolved on an Any kD TGX Stain-Free protein gel (4568126, BioRad) alongside a Chameleon Duo Pre-Stained Protein Ladder (928-60000 ...
-
bioRxiv - Biophysics 2019Quote: ... Residual Ca2+ from this solution was removed by passing 100 mL of TLK buffer over 5 g of pH-neutralized Chelex 100 resin (BioRad) in a column three times at a flow rate of ~3 mL/min ...
-
bioRxiv - Molecular Biology 2021Quote: ... After centrifugation (50 x g for 5 min) the Ni-NTA agarose beads were transferred to an empty Bio-Spin Chromatography column (Biorad). The column was extensively washed with 20 CV (column volume ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were diluted into 5 ml 1X PBS and sorted and analysed with a S3e(tm) Cell Sorter and ProSort(tm) Software (BioRad). Fluorescence intensities of cells were measured using 488 nm and 561 nm lasers ...
-
bioRxiv - Biochemistry 2020Quote: Aliquots (250 μg total protein) of hippocampal extracts of WAR animals subjected to freeze/thaw were treated with 5 μL of dithiothreitol (Biorad) 50 μg/μL ...
-
bioRxiv - Neuroscience 2020Quote: ... gels (4.5% acrylamide stacking gel and 10% acrylamide resolving gel) and were then transferred to 0.45 µm nitrocellulose membranes (Bio-Rad) using a semi-dry transfer system (Trans-Blot Turbo ...
-
bioRxiv - Biophysics 2021Quote: ... Purified TREK-2 was then mixed with GUVs to a final concentration of ∼1 - 5 µg/ml and incubated overnight at 4 °C with 0.5mg/ml Bio-Beads (Bio-Rad) prior to use.
-
bioRxiv - Genomics 2021Quote: ... Libraries generated by the same protocol were pooled and separated on 5% TBE-PAGE on Mini-PROTEAN tetra cell (BioRad) (Suppl.5 ...
-
bioRxiv - Cell Biology 2019Quote: ... a total of 15 μg siRNA (5 μg from each siRNA) was transferred to a 4-mm cuvette (Bio-Rad) and 5-10×106 DCs were added in 200 μl OptiMEM and incubated for 3 min before being pulsed with an exponential decay pulse at 300 V ...
-
bioRxiv - Genetics 2019Quote: ... Protein samples were denatured at 95°C for 5 min in appropriate loading buffer and loaded into precast SDS-PAGE gels (10% polyacrylamide; Biorad). Gels were run at 40 mA for 45 min in 1x running buffer (Fisher) ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μl of 10-fold diluted cDNAs was used for qRT-PCRs using a CFX96 real-time PCR machine (BioRad) with a SYBR solution (Eurogentec ...
-
bioRxiv - Genetics 2020Quote: ... nduo-5 and ctb-1 with act-1 as control by iQ™ SYBR® Green Supermix (BIO-RAD, #1708880).
-
bioRxiv - Cell Biology 2021Quote: Purified substrates and enzymes were centrifuged (16,000 g, 5 min, 4°C) before protein concentration was determined by Bradford assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: qPCR reactions were carried out in 25 µl total volume containing 5 ng of cDNA sample and 0.3 µM designed primers and SYBR Green Master Mix (Bio-Rad). Amplification was performed by Step One Plus (Applied Bio System ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lysates were denatured by boiling in 1x Laemmli buffer at 95°C for 5 minutes and loaded on a 4–20% gradient gel (BioRad). PVDF membranes were used for proteins wet transfer (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... was boiled at 95⁰C for 5 minutes prior to electrophoresis on a 4-20% gradient SDS-PAGE gel (BioRad). Membrane was blocked with 5% skim milk in TBST 1x on rocker for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples (10 µg protein) were denatured at 95°C for 5 min in 4x Laemmli Sample Buffer (1610747, Bio-Rad) or Novex NuPAGE LDS Sample Buffer (NP0007 ...
-
bioRxiv - Physiology 2021Quote: ... membrane-enriched fraction: 5 μg per lane) were loaded onto a 7.5% polyacrylamide mini gel (Bio-Rad, Hercules, CA, USA) – alternating between control and high CO2 treatments to avoid possible gel lane effects ...
-
bioRxiv - Immunology 2020Quote: ... and membrane blocking was performed overnight at 4°C in Tris-buffered saline (TBS) containing 0.2% Tween 20 (V/V) (TBST) and 5% (W/V) Blotting-Grade Blocker (Bio-Rad). Following overnight blocking ...
-
bioRxiv - Molecular Biology 2020Quote: ... proteins in loading buffer were boiled for 5 min before loading on to 12-15% SDS-PAGE gels using the Mini-Protean III gel system (BioRad). A protein transfer apparatus (BioRad ...