Labshake search
Citations for Bio-Rad :
151 - 200 of 2612 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and 5% β-mercaptoethanol and resolved on Mini-PROTEAN or CRITERION precast gels (Bio-Rad) or home-made 6% polyacrylamide gels (MCM7 ...
-
bioRxiv - Microbiology 2024Quote: ... Phenotypic carbapenemase characterization was performed with the imipenem hydrolysis test (β-CARBA test, Bio-Rad), immunochromatography with the NG-test CARBA 5 (NG Biotech ...
-
bioRxiv - Molecular Biology 2022Quote: ... using 10 mM CAPS buffer (3-[cyclohexylamino]-1-propanesulfonic acid [pH 11]) in a Mini Trans-Blot Electrophoretic Transfer Cell tank (Bio-Rad) according to protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 10 µL cDNA reaction was diluted to 200 µL and 3 µL was used with iTaq Universal SYBR Green Supermix (Bio-Rad) and 670 nM of primer pairs (Table S4 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The membranes were then washed with TBST again 3 times for 15 min before adding Goat Anti-Mouse IgG (H + L)-HRP antibody (1706516, Bio-Rad) 1:10000 in blocking buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Physiology 2021Quote: ... Samples were prepared in reducing conditions with β-mercaptoethanol in 4x Laemmli Sample Buffer (BioRad, 1610747) and heated at 95C for 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were boiled for 10 min at 96 °C in 1X LB with β-Mercaptoethanol (BioRad) and analyzed by WB.
-
bioRxiv - Microbiology 2023Quote: ... 5% β-mercaptoethanol) and detected by Western blotting using StrepTactin-HRP (Bio-Rad catalog number 1610381). To prevent signal saturation ...
-
bioRxiv - Cancer Biology 2022Quote: ... p53 and β-actin primary antibodies were diluted in 5% milk (Bio-Rad, Hercules, CA, USA) in TBST ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were denatured by addition of 2X Laemmeli buffer/10% β-mercaptoethanol (Bio-Rad/Sigma, respectively) to samples and subjection of samples to boiling for 2 min at 95°C ...
-
bioRxiv - Microbiology 2022Quote: ... The protein sample was diluted with Laemmli buffer containing β-mercaptoethanol (Bio-rad, Hercules, CA, USA) and incubated at 65°C for 5 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Immunology 2023Quote: ... unreacted ITC-DTPA was removed by dialysis against 0.25 M ammonium acetate (NH4Ac) pH 5.4–5.5 (metal free) supplemented with 2 g/L Chelex (Bio-Rad) using 20,000 molecular weight cut-off dialysis cassettes (Slide-a-Lyzer ...
-
bioRxiv - Plant Biology 2022Quote: ... For α-ACTIN-2 the secondary antibody Goat Anti-Mouse IgG (H + L)-HRP conjugate (1706516, Bio-rad) was used at a dilution of 1:5000 ...
-
bioRxiv - Bioengineering 2020Quote: ... 0.4% β-mercaptoethanol) per lane or 1 μL of strep-tagged unstained protein standards (Bio-Rad # 1610363) and run at 100 V for 2 h in Tris-HCl-Glycine-SDS running buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% β-mercaptoethanol) and resolved on Any kD Criterion TGX Precast Stain-free gels (5678124, Bio-Rad). Proteins were transferred to 0.2 µm PVDF membranes using a TransBlot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: EV protein aliquots were lysed by boiling with 20% β-mercaptoethanol in 4X Laemmli buffer (Bio-Rad) for 5 min at 100°C ...
-
Development of ketobenzothiazole-based peptidomimetic TMPRSS13 inhibitors with low nanomolar potencybioRxiv - Pharmacology and Toxicology 2024Quote: ... with 2.5 % β-mercaptoethanol and separated on 4-15 % SDS-page precast gels (Bio-Rad Laboratories, 4561084). Proteins were transferred on nitrocellulose membranes (iBlot 2 transfer stacks ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Pathology 2024Quote: ... non–linear 3-10 pH gradient (Bio-Rad), followed by SDS-PAGE separation on 8-16% polyacrylamide gradient midi gels (Criterion TGX gels ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...
-
bioRxiv - Cell Biology 2020Quote: ... Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad. Trizol reagent ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 1X Tris/glycine buffer (diluted from 10X Tris/glycine buffer, Bio-Rad 161-0771). The membrane was blocked in 5% milk in 1X TBS-T (diluted from 10X TBS-T ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...