Labshake search
Citations for Bio-Rad :
451 - 500 of 2612 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... in 1X Tris/glycine buffer (Bio-Rad, #161-0771) at 70V for 90 min in the cold room (4°C) ...
-
bioRxiv - Cell Biology 2021Quote: ... by wet transfer in Tris-glycine buffer (Bio-Rad) supplemented with 15% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... and run in Tris/Glycine/SDS running buffer (BioRad). Gels were stained with Coomassie Brilliant Blue or proteins were transferred into nitrocellulose membranes in Trans-Blot-Turbo Transfer Buffer (BioRad ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.1M glycine (161-0718; Bio-Rad, Hercules, CA, USA), 0.02% sodium azide (S2002 ...
-
bioRxiv - Cell Biology 2022Quote: ... premade Tris/Glycine/SDS electrophoresis buffer (BioRad, #161-0732), and BenchMark protein ladder (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... in 1 x Tris/Glycine buffer (Biorad #161-0772) 20% methanol ...
-
bioRxiv - Neuroscience 2021Quote: ... Glycine and Protein Assay Dye Reagent from Bio-Rad. Protease inhibitor cocktail was from Roche cOmpleteTM ...
-
bioRxiv - Cell Biology 2022Quote: ... we used 7.5% Tris-glycine midi-gels (Bio-Rad).
-
bioRxiv - Cancer Biology 2022Quote: ... and run in 1X Tris Glycine SDS buffer (BioRad) at 50 V for 5 min and 150 V for 45 min ...
-
bioRxiv - Neuroscience 2023Quote: Samples were resolved on 10% Tris-glycine gels (BioRad) and blocked in 5% milk in TBS plus 0.1% Tween 20 ...
-
bioRxiv - Neuroscience 2022Quote: ... immersed in Tris-glycine-SDS running buffer (Biorad 1610772). Samples were run for 1 hour at 120 V and then transferred overnight at 4°C with 30 V to a nitrocellulose membrane (Fisher NC9680617 ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732). 5 μL of either WesternSure Pre-stained Chemiluminescent Protein Ladder (LI-COR #926-98000 ...
-
bioRxiv - Physiology 2023Quote: ... and incubated with 50 mM glycine (BioRad, Hercules, CA) for 10 min to reduce aldehydes ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were electrophoresed through Tris/Glycine gels (Bio-Rad). Western blots were imaged using ChemiDoc (Bio- Rad) ...
-
bioRxiv - Bioengineering 2023Quote: ... separated on Tris-glycine/SDS-PAGE gels (Bio-Rad), followed by transfer to 0.45 μm nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... in running buffer (Tris-Glycine-SDS buffer; Bio-Rad) at 100V until the dye front reached to the bottom ...
-
bioRxiv - Cell Biology 2023Quote: ... in Tris-Glycine Transfer Buffer (Bio-Rad Cat# 1610771) + 10% methanol ...
-
bioRxiv - Biochemistry 2023Quote: ... loaded into 4 –20% Tris-Glycine gels (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% Tris-Glycine (BioRAD precast gradient gels 5671084) were used for protein separation ...
-
bioRxiv - Cell Biology 2024Quote: ... in tris-glycine-SDS buffer (Bio-Rad; catalog # 1610772) and transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Gels were run in Tris/Glycine/SDS buffer (BioRad) for 50 min at 150 V ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were electrophoresed using Tris/Glycine gels (Bio-Rad). Western blot imaging was conducted using ChemiDoc (Bio-Rad) ...
-
bioRxiv - Genomics 2024Quote: ... using 10x Tris/Glycine/SDS (Catalog#1610732, BIO-RAD) and transferred onto polyvinylidene difluoride membranes 0.2 um (Catalog# LC2002 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... using Tris/Glycine/SDS running buffer (Bio-Rad, 1610732). Gels were transferred to nitrocellulose membranes (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... or in 1x Tris-glycine-SDS running buffer (BioRad). Proteins were transferred onto Trans-Blot® Turbo™ Mini PVDF Transfer membranes with the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were separated on Tris-glycine 4-15% (Biorad) and transferred to PVDF membranes ...
-
bioRxiv - Neuroscience 2024Quote: ... in Tris-Glycine Transfer Buffer (Bio-Rad Cat# 1610771). Blots were blocked with Intercept Blocking Buffer (LI-COR ...
-
bioRxiv - Pathology 2024Quote: ... in 1X SDS-Tris-glycine buffer (Bio-Rad, #1610772EDU). Gradient gels were then transferred to 0.45-μm nitrocellulose membranes (VWR ...
-
bioRxiv - Pathology 2024Quote: ... in 1X SDS-Tris-Glycine buffer (Bio-Rad, #1610772EDU). The gradient gels were transferred onto 0.45-μm nitrocellulose membranes (VWR ...
-
bioRxiv - Cancer Biology 2024Quote: ... in 1x Tris/Glycine/SDS buffer (Bio-Rad, #1610772). Proteins were subsequently blotted onto 0.45μm PVDF membranes (Millipore Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... using SDS running buffer containing 1x Tris/glycine (BioRad) and 3.5 mM SDS (Serva Electrophoresis) ...
-
bioRxiv - Bioengineering 2020Quote: ... CTGGTTGTCAGGGGAGTGTT), CD206 (FP: CAAGGAAGGTTGGCATTTGT, RP: CCAGGCATTGAAAGTGGAGT), and β-actin (FP: GCCTTCCTTCTTGGGTATGG, RP: CAGCTCAGTAACAGTCCGCC) by RT-PCR using iTaq SYBR Supermix (Bio-Rad, Cat# 1725125) on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein extracts (50 μg of protein) in β-mercaptoethanol containing SDS sample buffer were separated in 4% to 12% gradient SDS-polyacrylamide gels (Bio-Rad #456-8094) and transferred to nitrocellulose membranes (Bio-Rad #170-4271 ...
-
bioRxiv - Cancer Biology 2021Quote: ... expression levels were expressed as the ratio of the gray level of each sample to its internal reference β-actin control and analyzed by QuantityOne program (Bio-Rad, Hercules, USA) (31).
-
bioRxiv - Cell Biology 2021Quote: ... Bead pellets were resuspended and boiled in β-mercaptoethanol containing Laemmli sample buffer were separated in 4% to 12% gradient SDS-polyacrylamide gels (Bio-Rad #456-8094) and transferred to nitrocellulose membranes (Bio-Rad #170-4271 ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein extracts (50 µg of protein) in β-mercaptoethanol containing SDS sample buffer were separated in 4% to 12% gradient SDS-polyacrylamide gels (Bio-Rad #456-8094) and transferred to nitrocellulose membranes (Bio-Rad #170-4271 ...
-
bioRxiv - Bioengineering 2023Quote: ... Membranes were blocked using 5% BSA in 1X TBST and incubated overnight with primary antibody (anti-Cas9; 1:1000 dilution, Diagenode #C15200216, Anti-FLAG; 1:2000 dilution, Sigma-Aldrich #F1804, anti-β-Tubulin; 1:1000 dilution, Bio-Rad #12004166). Then membranes were washed with 1X TBST 3 times (10mins each wash ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were quantified by normalizing the intensity of the protein band of interest to the intensity of the β-actin band in the same lane using the Image Lab software (Bio-Rad, Hercules, CA).
-
bioRxiv - Plant Biology 2024Quote: ... Samples equivalent to 1 µg chlorophyll were solubilized with 2X sample buffer (Laemmli buffer + 6M urea + β-mercaptoethanol + Bromophenol blue) for 5 min at 75°C and loaded onto 12% Mini-PROTEAN® TGX™ Precast Gels (Bio-Rad). After protein separation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Membranes were blocked using 5% BSA in 1X TBST and incubated overnight with primary antibody (anti-Cas9; 1:1000 dilution, Diagenode #C15200216, Anti-FLAG; 1:2000 dilution, Sigma-Aldrich #F1804, anti-β-Tubulin; 1:1000 dilution, Bio-Rad #12004166). Then membranes were washed with 1X TBST 3 times (5 mins each wash ...
-
bioRxiv - Cell Biology 2021Quote: ... Blocking solution consisted in 3% nonfat dry milk (Blotting-Grade Blocker, BIO-RAD Laboratories ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μL cDNA template and 4 μL iQ SYBR green supermix (Bio-Rad) in a total reaction volume of 12 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated on a 3-8% Criterion XT tris-acetate gel (Biorad) or 4-15% Criterion TGX gel according to the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... were resolved by 10% denaturing PAGE in Mini Protean 3 Cell (Bio-Rad). Separated RNA was then transferred to a nylon membrane (Hybond-XL ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 3 uL Precision Plus Protein All Blue prestained standards (Bio-Rad, #1610373) loaded as a ladder ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μl of 2x iProof HF Master Mix (BioRad, Hercules, CA, USA). The 3 μl of 2x master mix was dispensed using a Mantis Liquid Handler (Formulatrix ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µl DTT and 1000 µl Purezol (Biorad, USA, CA, Cat No: 7326890) were added to each falcon tube and kept on ice for 5 minutes ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Bioengineering 2024Quote: 3⋅108 total particles were loaded into pre-cast gels (BioRad, Cat. # 4561094). Samples were blocked in a 5% nonfat milk solution and stained for the common EV marker CD9 using a primary antibody (Cell Signaling Technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... and Precision Plus Protein Dual Color Standards (1610374, Bio-Rad, 3 μL/well). All antibodies used for western blotting were diluted at a ratio of 1:1000 or 1:500 unless otherwise specified ...