Labshake search
Citations for Bio-Rad :
151 - 200 of 347 citations for Fmoc Rink Amide OctaGel Resin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... The resin was then transferred to a Micro Bio-Spin Column (Bio-Rad) and washed with 25 mM HEPES pH 7.5 ...
-
bioRxiv - Biophysics 2024Quote: ... made fresh and deionized with MG AG 501-X8 (D) resin from Biorad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immobilized metal affinity chromatography (IMAC) resin was obtained from Bio-Rad (Hercules, California, USA). Sephadex G-25 Fine Resin was obtained from Amersham Biosciences (Amersham ...
-
bioRxiv - Cell Biology 2020Quote: ... Uncoupled nanobody and sortase were depleted using Ni-NTA resin (Biorad, Hercules, CA, USA). Unbound dye was removed using Zeba Spin Desalting Columns (ThermoFisher Scientific) ...
-
bioRxiv - Systems Biology 2022Quote: DNA was extracted from tails or ears using Chelex resin (Bio-Rad, Hercules, CA). The genotype of mice was determined by PCR using the primers described in (Itoh et al ...
-
bioRxiv - Biochemistry 2021Quote: ... The Ni2+-NTA resin was transferred to empty Econo-Pac® columns (Bio-Rad), washed with 15 mL IMAC A buffer containing 25 mM imidazole followed by elution with 1.6 mL IMAC A buffer containing 250 mM imidazole.
-
bioRxiv - Biophysics 2021Quote: ... The resin was packed in an Econo-column (Bio-Rad, 1.0 x 10 cm) and washed with high salt buffer (50 mM HEPES ...
-
bioRxiv - Bioengineering 2022Quote: ... The bacterial lysate/resin was loaded onto a Poly-Prep Chromatography Column (Bio-Rad) and drained by unit gravity flow ...
-
bioRxiv - Genetics 2022Quote: ... 186 μL of 5 % Chelex® 100 Resin (Bio-Rad Laboratories, Hercules, CA, USA) and 14 μL of proteinase K (20 mg/mL ...
-
bioRxiv - Biochemistry 2021Quote: ... The resin was transferred to a 2mL gravity-flow Poly-prep column (Bio-Rad). The column was washed twice with 2 mL of HisWash buffer (10mM HEPES ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the protein/resin solution was passed through an empty chromatography column (BioRad Econo-Pac), washed thrice with 20ml of binding buffer ...
-
bioRxiv - Microbiology 2021Quote: ... crude DNA was extracted from all isolates using 5% chelex-100 resin (Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... glyoxal was deionized using mixed bed resin (AG 501-X8, BioRad, Hercules, CA, USA). 10 ml of glyoxal was treated with 2g of mixed bed resin and was stirred for 2 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein was then purified by IMAC using nickel-NTA resin (Bio-Rad, Hercules, California). Depending on the protein and downstream experiments ...
-
bioRxiv - Biochemistry 2024Quote: ... The resin was then loaded into a glass Econo-Column (Bio-Rad Laboratories, CA), and washed with 30 column volumes of wash buffer (50 mM HEPES pH 6.5 ...
-
bioRxiv - Microbiology 2023Quote: ... The resin-lysate mixture was poured into a 1-cm separation column (Bio-Rad), the resin was allowed to pack ...
-
bioRxiv - Genetics 2023Quote: ... DNA was extracted from tails by using Chelex resin (Bio-Rad Laboratories, Hercules, CA). Presence of ChrY was detected using primers that amplify Med14X and Med14Y (forward primer CCTCCAGACCCTATTACCAA ...
-
bioRxiv - Neuroscience 2023Quote: ... the His-FUS proteins were mixed with Profinity IMAC Ni2+-charged resin (Bio-Rad) for 30 min at 20 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... The recombinant protein was purified using the Ni-NTA (Biorad IMAC Ni-Charged Resins) affinity chromatography under denaturing conditions ...
-
bioRxiv - Immunology 2024Quote: ... Excess APTS was removed using Bio-Gel P-2 size exclusion resin (Bio-Rad) (antigen specific glycans ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resin lysate suspension was then transferred to a 2.5×20 econo-column (Biorad) and resin collected before the bed was washed with 3 x 100 ml of wash buffer (50 mM HEPES pH 8 ...
-
bioRxiv - Microbiology 2024Quote: ... that was subsequently treated with detergent removing Bio-Beads SM-2 resin (Bio-Rad). The virus disassembly reaction consisted of influenza virus (1 ml)(2mg/ml ...
-
bioRxiv - Plant Biology 2024Quote: ... and the solution was de-metalated by passage through a Chelex 100 Resin (BioRad) column prepared according to (61) ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA extracted from tail tips using proteinase K digestion and Chelex 100 Resin (Biorad 1432832) was amplified for 30 cycles at 95 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting supernatant was loaded onto the nickel-charged Profinity IMAC Resin (Bio-Rad, USA) and washed with 15 column volumes (CV ...
-
bioRxiv - Bioengineering 2020Quote: ... Metals were removed from buffers using Chelex 100 metal affinity resin (Biorad, Laboratories, Hercules CA).
-
bioRxiv - Cell Biology 2021Quote: ... and later the resin was transferred to a Poly-Prep chromatography column (BioRad, Hercules, CA). The β-Spectrin-His protein was eluted in PBS containing 200 mM imidazole ...
-
bioRxiv - Plant Biology 2021Quote: ... the resins were transferred to a gravity flow column (Bio-Rad Laboratories, Hercules, CA, USA) and washed with 3 column volumes of wash buffer (50 mM NaPO4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resin was collected by gravity-flow through an Econo-Pac chromatography column (Bio-Rad), then washed with 24 mL of cold lysis buffer ...
-
bioRxiv - Biophysics 2022Quote: ... followed by anion exchange using Macro-Prep High Q Support resin (Bio-Rad, Hercules, California) with elution in 0.1 to 0.2 M sodium chloride ...
-
bioRxiv - Biochemistry 2021Quote: ... Soluble proteins were extracted by using Profinity IMAC Ni-charged resin (Bio-Rad, Hercules, CA) as recommended by the manufacturer ...
-
Gatekeeper helix activates Golgi SM protein Sly1 and directly mediates close-range vesicle tetheringbioRxiv - Cell Biology 2020Quote: ... Sly1-bound resin was collected in a 25 mL disposable Econo-Pac column (Bio-Rad) by gravity and washed with 25 mL of SLY1 buffer supplemented with 50 mM imidazole at pH 7 ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Beads SM-2 Resin and Bio-Gel P-6 were obtained from Bio-Rad Laboratories Inc ...
-
bioRxiv - Biophysics 2022Quote: ... lysate-resin suspension was loaded onto a 20 ml polypropylene gravity-flow column (Bio-Rad). After collecting the flow through ...
-
bioRxiv - Biophysics 2022Quote: ... lysate-resin suspension was loaded onto a 20 ml polypropylene gravity-flow column (Bio-Rad). After collecting the flow through ...
-
bioRxiv - Immunology 2024Quote: ... The resin was packed in a Poly-Prep chromatography column (Bio-Rad, Hercules, CA, USA) and washed with 20 volumes Buffer A ...
-
bioRxiv - Microbiology 2023Quote: ... Protein-bound resin was then applied to a 10-mL chromatography column (BioRad, Hercules, CA) and washed twice with 10 mL wash buffer (50 mM NaH2PO4 ...
-
bioRxiv - Biophysics 2024Quote: ... All buffers and AGARP samples used in experiments were treated with Chele× 100 resin (BioRad) to remove residual bivalent ions ...
-
bioRxiv - Bioengineering 2024Quote: ... in 0.1M sodium phosphate buffer pH 7.3 previously treated with Chelex 100 chelating resin (BioRad), and reacted at 4°C for 18 hr ...
-
bioRxiv - Biochemistry 2024Quote: ... Bound proteins were eluted by boiling the resin in 2x Laemmli Sample Buffer (BioRad #1610737), supplemented with 50 mM β-mercaptoethanol ...
-
bioRxiv - Biochemistry 2024Quote: ... purified and eluted from GSH resin through a Poly-Prep Chromatography hand-column (Bio-Rad) by addition of fresh glutathione-containing buffer (300 mM NaCl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Individual DNA was extracted in 200 μL 5% Chelex 100 Resin (Bio-Rad Laboratories, Hercules, CA) [36] ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture was then treated with 5% volume of Bio-Bead SM-2 resin (Bio-Rad) with shaking on ice for 15 min ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted in 250 μL 5% Chelex® 100 Resin (Bio-Rad Laboratories, Hercules, CA) and 3 μL of Proteinase K (20 mg/ mL ...
-
bioRxiv - Neuroscience 2020Quote: ... The proteins were eluted from the resin by boiling in 50ul 4×sample buffer (Bio-Rad) and 2.5ul 20×reducing reagent (Bio-Rad) ...
-
bioRxiv - Biophysics 2022Quote: ... the resin-bound SSTR2 was loaded onto a disposable chromatography column (Bio-Rad, Hercules, CA, USA) and the resin was washed with 20 column volumes (CVs ...
-
bioRxiv - Bioengineering 2021Quote: ... The mAb-containing fractions were finally polished with CHT chromatography with type II resin (Bio-Rad). The CHT columns were equilibrated and washed with phosphate running buffer and eluted with running buffer containing NaCl.
-
bioRxiv - Biochemistry 2020Quote: ... boric acid) Urea solutions were made fresh daily and incubated with AG 501-X8 resin (Biorad) for minimum 5 hours to remove ionic contaminants ...
-
bioRxiv - Molecular Biology 2022Quote: ... the resin and protein mixtures were added to a micro Bio-spin column (Bio-Rad 7326202). The flow-through was discarded ...
-
bioRxiv - Cell Biology 2022Quote: ... the resin was transferred into gravity flow chromatography columns (Poly-Prep® Chromatography Column, Bio-Rad) and washed 3 times with i ...