Labshake search
Citations for Bio-Rad :
151 - 200 of 4891 citations for Ethyl 5 4 methoxyphenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... the samples were treated with 5% 2-mercaptoethanol in Laemmli buffer and heated at 95°C for 5 minutes prior to loading into a 4-15% gradient SDS gel (Cat# 4568085, Bio-Rad) and run at 160v for 50-55 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were boiled at +90 °C for 5 min prior to protein separation using precast SDS- PAGE gradient gels (4–20% Mini-PROTEAN TGX, Bio-Rad) and transferred onto nitrocellulose membranes with the semi-dry Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Genomics 2024Quote: To investigate the presence of SRY in Brutus a PCR using primers specific for canine SRY (Forward: 5’ AAGGCCACGGCACAGAAAAGTCAC and Reverse: 5’ AAGAAGCGTCAGCGGACATCTGTG from (19) was performed using iProof HF Master Mix (BioRAD). Amplification was carried out in 25 μL reactions with 1 × PCR MasterMix ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of mixed primers containing 5 μM of each primer and 5 μl of iTaq Universal SYBR Green Supermix (BioRad), as previously described (Xavier et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% (w/v) NFDM (Biorad, cat no: 1706404) blocking was also performed for each antibody ...
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% non-fat milk (Bio-Rad) in TBST and incubated in primary antibodies (1:5000 rabbit anti-GFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... Non-denaturing 5% polyacrylamide 1xTBE Criterion gels (BioRad) were pre-run 30 minutes before loading the reactions.
-
bioRxiv - Biochemistry 2022Quote: ... with ImageLab Version 5 (Bio-Rad, Hercules, CA). Each experiment has three independent repeats.
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of Sosofast Eva Green (Bio-Rad) 2X master mix ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µl precision melt supermix (Bio-Rad, Germany) and 1 µl DNA was used for real-time PCR ...
-
bioRxiv - Immunology 2024Quote: ... then blocked with 5% blocking protein (Bio-Rad) for 1.5h at 37°C and washed four times again ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μL of SYBR Green mix (Bio-Rad) and 0.9 μL of RNase-DNase free water (Promega ...
-
bioRxiv - Genetics 2021Quote: ... Forty micrograms of total protein from hippocampal nuclear lysates was boiled for 5-minutes to dissociate complexes before separation in a 4-20% gradient gel (Bio-Rad 4561096) for 1-hour at 150V in 1x Tris/Glycine/SDS (Bio-Rad 1610732) ...
-
bioRxiv - Cell Biology 2022Quote: Protein homogenates (5 or 15 μg/lane) were size fractionated on 4–15% or 15% Criterion TGX gels (Biorad Laboratories, Oslo, Norway) and transferred to 0.45 μM PVDF-membranes (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2020Quote: ... To reduce non-specific binding single cell suspensions were incubated for 5 min at 4°C with PBS/10% AB-serum (Bio-Rad, Germany), subsequently stained with fluorescence-labeled or biotinylated antibodies for 15 min at 4°C and washed once with PBS/2% FCS/0.01% NaN3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein-containing lysates of exosomes (5 μg) were run on a 4–20% Mini-PROTEIN TGX gel (Bio-Rad, Hercules, California, USA) and transferred to a nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were heated to 95°C for 5 min and then analyzed on a 4-12% gel (Bio-Rad Laboratories, Hercules, CA) using SDS running buffer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1-5 μg of purified antigen or 20 μg protein extract were loaded in a precast 4-20% acrylamide gel (BioRad 456-1094). Gels were run for the first 20-30 min at 40V ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples are prepared for SDS-PAGE by adding 5 μl of sample to 4 μl of tricine sample buffer (Bio-Rad 1610739) and 1 μl of 1 M DTT and heat denaturing at 70 °C for 3 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were prepared for SDS-PAGE by adding 5 μl of sample to 4 μl of tricine sample buffer (Bio-Rad 1610739) and 1 μl of 1 M DTT and heat denaturing at 90 °C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were boiled at 95°C for 5 min and loaded into 4-12% Criterion XT-Bis-Tris polyacrylamide gels (Bio-Rad 3450125). Gel electrophoresis was performed in 1X MES running buffer (Bio-Rad 1610789 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Table 1) was performed at 4°C overnight at a 1:1000 dilution in 5% nonfat dry milk (Bio-Rad No. 1706404). Incubation of HRP conjugated secondary antibody (different species ...
-
bioRxiv - Biochemistry 2024Quote: ... and boiled at 95° C for 5 minutes before separation on 4–20% Mini-PROTEAN® TGX™ Precast Protein Gels (BioRad). In-gel fluorescence was imaged first ...
-
bioRxiv - Microbiology 2024Quote: ... protein samples were boiled at 95 °C for 5 min and separated by a 4–20% Mini-PROTEAN® TGX Stain-Free™ SDS PAGE (BioRad) or 12 % Tris-Glycine SDS PAGA (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... Each sample was then boiled for 3-5 min at 95 ºC and resolved on a 4-20 % gradient SDS-PAGE gel (TGXTM, Bio-Rad, 4561096) at 180 Volts for ∼30 min ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL diluted cDNA (5 ng) in a total volume of 5 μL using a CFX384 Real-Time System (Bio-Rad). For each experimental sample (four source colonies ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...