Labshake search
Citations for Bio-Rad :
1 - 50 of 4891 citations for Ethyl 5 4 methoxyphenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were then incubated (4°C, overnight) with 5 % milk powder (BioRad) in TBST ...
-
bioRxiv - Neuroscience 2022Quote: ... 5-20μg protein were loaded onto 4-20% SDS-PAGE gels (Biorad) and run at 100V ...
-
bioRxiv - Plant Biology 2020Quote: ... The mixture was kept for 5 min at 95°C and 5 min on ice before loading on a TGX 4-20% Strainfree (Bio-Rad US) gel immersed in TGS 1X buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... 5%β-mercaptoethanol) and migrated on 4-15% Tris-glycine gradient gels (BioRad).
-
bioRxiv - Neuroscience 2021Quote: ... 5-10µg protein were loaded on SDS-PAGE gels (4-15% acrylamide, Biorad). After 1h of electrophoresis at 150V ...
-
bioRxiv - Cell Biology 2023Quote: ... and resolved by SDS-PAGE using Criterion XT Bis-Tris precast gels (4-12%; BioRad, 3450123/4/5) and XT-MES1X as running buffer (stock 10X ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins (5 μg) were separated on a 4–15 % polyacrylamide gradient gel (Bio-Rad) and then transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... then heated at 90°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... boiled for 5 minutes and resolved on 4 to 20% TGX mini protean gels (Bio-Rad). The proteins were transferred to PVDF membranes using BioRad Trans-Blot semi-dry transfer ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg of sample were loaded on a 4-to-20% SDS polyacrylamide gel (Bio-Rad). Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl aliquots were separated on 4–20 % Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad) and stained with Instant Blue (Expedeon) ...
-
bioRxiv - Immunology 2024Quote: ... followed by centrifugation for 5 minutes at 12,000 rpm at 4°C (Bio-Rad, Hercules, CA). After centrifugation ...
-
bioRxiv - Cell Biology 2024Quote: ... then heated at 95°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Cell Biology 2020Quote: ... which then heated at 90°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... Denatured protein lysates (5 μg) were loaded in 4–20% Criterion TGX Precast Gels (Bio-Rad, 5678095) and transferred to Immobilon-FL PVDF membrane (0.45 μm pore ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated overnight at 4°C with primary antibodies dissolved in 5% Blotting-Grade Blocker (Bio-Rad). All primary antibodies and dilutions used are listed in Supplementary Table STm.1 ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... boiled for 5 min and loaded on a 4-15% Criterion TGX Stain-Free precast gel (BioRad). Protein samples were transferred unto a PVDF membrane (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... All samples were acquired on a ZE5 5-laser or 4-laser cell analyzer (Bio-rad laboratories) and analyzed with FlowJo software (Tree Star) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
bioRxiv - Genomics 2023Quote: ... 10% glycerol) containing 5% ß-mercaptoethanol before SDS-PAGE on a 4-15% polyacrylamide gel (Bio-Rad). Proteins were transferred onto a nitrocellulose membrane blocked with AdvanBlock-Chemi blocking solution (Advansta ...
-
bioRxiv - Biochemistry 2023Quote: mtHsp60V72I (10 μL of 5 μM monomer) was loaded on a 4-15% TGX gel (Bio-Rad), run for 30 min at 200 V ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were incubated shaking for 1 hour at RT with 4% blocking solution (5% milk powder (BioRad) in TBS-T) ...
-
bioRxiv - Cell Biology 2024Quote: ... SARS-CoV2-PP were prepared by labelling with 0.4µM DiIC18(5) solid (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt, or DID) (Thermo) with Biospin6 (Biorad) to remove residual dyes ...
-
bioRxiv - Biochemistry 2024Quote: ... 5% beta-mercaptoethanol) and run on 4-20% mini-PROTEAN TGX precast polyacrylamide gels (Bio-Rad #4561096) in Tris-glycine-SDS running buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Microbiology 2020Quote: ... The membranes were incubated overnight at 4°C in blocking solution 5% (w/v) Blotting-Grade Blocker (BioRad) in PBS-Tween buffer (1× PBS ...
-
bioRxiv - Cell Biology 2022Quote: Equal volumes (5 µg) of the prepared co-IPs were separated by SDS-PAGE (4–15%, Bio-Rad) and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated 5 min at 95 °C and separated on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins could be detected with an infrared imager (Odyssey ...
-
bioRxiv - Molecular Biology 2023Quote: ... heated at 95°C for 5 min then run on a 4-12% Bis-Tris gel (BioRad 3450125). The input sample is identical to the initial solution containing protein in 60 μL 1x selection buffer prior to capture with 20 passages over the ME200 tip ...
-
bioRxiv - Neuroscience 2023Quote: ... with 5% β-Mercaptoethanol then loaded on 4-20% Criterion TGX Precast Midi protein gels (Bio-Rad #5671094). The gels were run in TGS buffer (1x ...
-
bioRxiv - Biochemistry 2024Quote: ... boiled for 5 min and then resolved on 4-20% (w/v) gradient SDS-PAGE gels (Bio-Rad) with Tris-glycine buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... TGF-β1 (5 ng/mL, BioRad), or a combination of DEX (10-6M ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% non-fat milk (Bio-Rad) was used as the blocking agent for primary antibodies detecting non-phosphorylated proteins and all horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam ...
-
What challenges remain in harmonizing cytomegalovirus viral load quantification across laboratories?bioRxiv - Microbiology 2024Quote: ... (iv) 5 duplicates from Bio-Rad’s Exact Diagnostics Verification Panel 1.4 mL (CMVP200 ...
-
bioRxiv - Cell Biology 2024Quote: ... blocked in 5% milk (1706404, BioRad) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... samples were boiled for 5 min and equal volumes were loaded onto a 4-15% gradient gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Developmental Biology 2020Quote: ... the membrane was blocked overnight at 4°C using 5% non-fat dry milk (Bio-Rad, catalog 170-6404) in Tris-buffered saline pH 7.3 ...