Labshake search
Citations for Bio-Rad :
151 - 200 of 2886 citations for Ethyl 5 2 3 difluorophenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were incubated with appropriate primary and secondary antibodies listed in Table 2 in 5% milk and developed using the Clarity Western enhanced chemiluminescence substrate system (1705060, Bio-Rad) in a Xograph Compact X5 processor ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified supernatant was filtered through a 0.4 μM filter to remove the insoluble fraction and supplemented with 30 mM Imidazole pH 7.0 immediately before loading at a flow rate of 2 mL/min onto a 5 mL Ni-NTA immobilized metal affinity chromatography (IMAC) column (Bio-Rad) equilibrated in Buffer A (50 mM Tris-Cl ...
-
bioRxiv - Cancer Biology 2020Quote: ... The beads were washed five times with IP lysis buffer and were boiled for 5-10 min in 2 times Laemmli sample buffer (#1610737, Bio-Rad) with 2-mercaptoethanol (#BP176-100 ...
-
bioRxiv - Immunology 2020Quote: ... in reducing or nonreducing conditions using SuperSep Ace 5%–20% gradient polyacrylamide gel (FUJIFILM Wako Pure Chemical, Osaka, Japan) and 2 × Laemmli Sample Buffer (Bio-Rad).
-
bioRxiv - Immunology 2021Quote: Protein analysis was performed using Bioplex assays (27-Plex, CXCL-1-, CXCL-2-, CXCL-5-, CCL22-single plex) (Bio-Rad Laboratories) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was filtered through a 0.4 μM filter to remove the insoluble fraction and supplemented with 30 mM Imidazole pH 7.0 immediately before loading at a flow rate of 2 mL/min onto a 5 mL Ni-NTA immobilized metal affinity chromatography (IMAC) column (Bio-Rad) equilibrated in Buffer A (50 mM Tris-Cl ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by washes at room temperature (1 x 15 min, 2 x 5 min) and incubation with HRP-conjugated secondary antibodies (Bio-Rad) for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription (RT) was performed from 2 to 5 µg of RNA with iScript Adv cDNA synthesis kit (Bio-Rad #1725038). The cDNA was diluted 5 times and 1 μL of this was used for each reaction in real-time PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 mM 2-mercaptoethanol) and protein concentration measured using Bradford method (Bio-Rad Protein Assay Dye Reagent Concentrate; Bio-Rad Laboratories).
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were resuspended in 2 ml of 10% sorbitol and 40 μl per transformation mixed with up to 5 μl of plasmids were electroporated in 2 mm cuvettes (Gene Pulser Xcell BIO-RAD). For autoactivation controls ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL diluted cDNA (5 ng) in a total volume of 5 μL using a CFX384 Real-Time System (Bio-Rad). For each experimental sample (four source colonies ...
-
bioRxiv - Biophysics 2022Quote: ... After boiling the beads at 95°C for 5 min in 2X Laemmli sample buffer with 5% β-mercaptoethanol (Bio-Rad), the immunoprecipitated protein was resolved on 10% SDS-PAGE gels and then transferred onto 0.45 μm PVDF membrane (GE ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed 5 X 5 min in TBST and signals were detected using the Clarity Western ECL Substrate (Biorad #1705060). At least 2 separate gels were immunoblotted with cortical extracts from independent litters and used for quantitation.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed by mixing 5 μl of 5-times diluted cDNA with 10 μl of iTaq Universal SYBR Green mix (Bio-Rad), 3.6 μl of water and 0.8 μl of forward and reverse primers listed in Supplementary Table 1 ...
-
Self-assembled DNA-collagen bioactive scaffolds promote cellular uptake and neuronal differentiationbioRxiv - Bioengineering 2024Quote: ... The macrostructure was assembled by heating the primers at 95 °C for 30 min and then cooling them to 5 °C with a step decrease of 5 °C every 15 min using a PCR instrument (BioRad, USA). The resulting macrostructure was then stored at 4 °C until required ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA primers for PMS2 (5’ATAACGTGAGCTCCCCAGAA; 5’ GAGGACCAGGCAATCTTTGA) and ACTIN (5’GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT) were used to amplify target mRNA using iTaq Universal SYBR Green (Biorad, 1725120) and quantified on (Biorad CRX Connect Real-Time PCR Detection System ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Immunology 2024Quote: Organoids and Mode-K cells were incubated at 37°C with 5% CO₂ in culture media supplemented with 5 µg/mL PureBlu Hoechst (Bio-Rad) and 5 µg/mL Propidium Iodide ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then washed five times in 5% TBST (5 minutes each) and incubated with goat anti-mouse IgG secondary antibody (PCS 1706516, Bio-Rad) at a 1:3000 dilution in 5% milk powder in TBST for 1 hour at room temperature ...
-
bioRxiv - Systems Biology 2021Quote: ... incubated 5 min at 65 °C and separated by 12% SDS-PAGE (65) in the Mini Protean 3 Apparatus (BioRad Laboratories, Hercules, CA, USA). The final concentration of proteins was 10 μg per lane ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the miR200c primers (upstream primer, 5’- TAATACTGCCGGGTAATGATGGA-3’) (Eurofins Genomics) on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). U6 primers (TAKARA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The same AAV2 ITR primers were used for ddPCR along with a FAM labeled probe 5 ’-CACTCCCTCTCTGCGCGCTCG-3 with the QX200 Bio-rad Laboratories’ droplet digital system (Bio-rad Laboratories, California, USA) and ddPCR supermix for probe (Bio-rad Laboratories ...
-
bioRxiv - Plant Biology 2020Quote: ... The mixture was kept for 5 min at 95°C and 5 min on ice before loading on a TGX 4-20% Strainfree (Bio-Rad US) gel immersed in TGS 1X buffer ...
-
bioRxiv - Plant Biology 2020Quote: ... we used 2 µl of a 1/5 dilution of the cDNA obtained as above in a reaction containing 5 µl of SsoFast EvaGreen (Bio-Rad, USA), 0.5 µl of Forward primer (10 µM ...
-
bioRxiv - Pathology 2021Quote: ... CST #2118) in 5% bovine serum albumin (total protein antibodies) or 5% dry milk (phospho-specific antibodies) Tris buffered saline (Bio-Rad #1706435) with 0.1% Tween-20 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.5 µL of each forward and reverse primer (10 µM) and 5 µL of SsoADV Universal SYBR® Green Supermix (Bio-Rad) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed again with TBST buffer for 5 times X 5 min and developed using Clarity Western ECL substrate (Bio-Rad, 1004384863). Images were captured on a Luminescent Image Analyzer (GE Healthcare ...
-
bioRxiv - Neuroscience 2024Quote: ... was carried out with 5 ng of cDNA in a volume of 4 μl with 1 μl of 5 μM forward and reverse primers mix and 5 μl of SsoFast EvaGreen Supermix premix (Biorad, CN172-5204). Triplicate reactions were carried out for each mRNA ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were blocked with 5% non-fat milk (BioRad) in 1X PBS with 0.1% of Tween 20 (PBS-T ...
-
bioRxiv - Immunology 2021Quote: ... containing 5% Blotting-Grade Blocker (Bio-Rad, # 170-6404) for 1□h ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 µL 2X SSOAdvanced SYBR Green PCR mix (BioRad), and 10 µM each of primer ( total volume ...
-
bioRxiv - Cancer Biology 2021Quote: ... After blocking in 5% non-fat milk (Bio-Rad) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% dry milk (Bio-Rad), incubated with goat polyclonal anti-ACE2 (R&D Systems AF3437 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membrane was blocked in 5% blocking reagent (Biorad) dissolved in TBS-T rocking for > 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked using 5% non-fat milk (Biorad) in TBST (0.1% Tween-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... blots were incubated in 5% milk blocking buffer (BioRad) for 1 hour at 4°C before primary antibody overnight at 4°C (See Table 1) ...
-
bioRxiv - Immunology 2020Quote: ... Siglec-7 (5-386, Alexa Fluor 488, Bio-Rad), TIM-3 (7D3 ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μl of anti-Pk antibody (Bio-Rad, MCA1360)-bound Protein A conjugated magnetic beads were added to the reactions and rotated at 25 °C for 10 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... Membrane was blocked with 5% nonfat milk (Bio-Rad) in TBS-T for 2 hours at room temperature and incubated with primary antibodies overnight at 4°C (Extended Data Table 4).
-
bioRxiv - Molecular Biology 2020Quote: ... 5% methanol) using a trans-blot system (Bio-Rad). Blocking the PVDF membrane was performed by shaking in TBS-T (10 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... followed by blocking with 5 % skim milk (Bio-Rad) in TBST buffer (50 mM Tris/HCl ...
-
bioRxiv - Cancer Biology 2020Quote: ... After blocking with 5% fat free dry milk (Biorad) membranes were probed with primary antibodies listed in Table 1 overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and blocked in 5% blotting grade blocker (Bio-Rad). Membranes were incubated with primary antibodies overnight (FOXA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... membranes were blocked using 5% skimmed milk (Bio-Rad) in TBST (TBS buffer containing 0.5% Tween-20 ...
-
bioRxiv - Bioengineering 2020Quote: ... Membranes were blocked in 5% blotto-PBST (Bio-Rad) and incubated with primary antibodies (Supplemental Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... After membranes were blocked in 5%-milk (Biorad 1706404), the following primary antibodies were applied overnight at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions were resolved on 5% TBE gel (3450048, BioRad) with 0.5X TBE buffer (1610733 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Membranes were blocked with 5% non-fat milk (Biorad) in TBS-T (20mM Tris-HCl pH7.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... Chelex 100 Chelating Resin (5 g, BioRad, Hercules, California) was added to 100 ml of each buffer ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 µL 2X SSOAdvanced SYBR Green PCR mix (BioRad), and 10 µM each of primer ...