Labshake search
Citations for Bio-Rad :
101 - 150 of 2886 citations for Ethyl 5 2 3 difluorophenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... containing 5% β-mercaptoethanol (Bio-Rad, 1610710), boiled for 5 minutes at 95°C and loaded onto Mini-Protean TGX Stain Free Gels 4-20% (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... + 5 % βmercapto-ethanol (BioRad ref #161-0710), and heated for 5 min at 70°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-phospho-p38 MAPK (Thr180/Tyr182 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% blotting grade blocker (Bio-Rad, 1706404XTU). The primary antibodies used are listed in Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... After blocking with 5% BSA (BIO-RAD) in 1 X PBS at room temperature for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantum™ FITC-5 MESF beads (BioRad) were used according to the manufacturer’s protocol to estimate the length of telomeres quantitatively ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing 5% of nonfat milk (BIO-RAD). TBS-T buffer was used for all the membrane washings ...
-
bioRxiv - Developmental Biology 2024Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-FLAG M2 (F1804 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were blocked in 5% milk (Biorad) or 3% BSA (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Membranes were then washed 3 times for 5 min in TBST before detection using Clarity Western ECL Substrate (Bio-rad, 170-5061) and imaging on a ChemiDoc MP (Bio-rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... carried out in glass tubes filled with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (Bio-Rad, USA) overnight at 4 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 300 nM concentration of each primer targeting the viral DNA substrate (5’- AGCGTGGGCGGGAAAATCTC-3’) and the indicated target DNA (table 1) and 1X iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories). The qPCR cycling conditions for quantifying INS activity included an initial incubation at 95°C for 3 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... Each sample was then boiled for 3-5 min at 95 ºC and resolved on a 4-20 % gradient SDS-PAGE gel (TGXTM, Bio-Rad, 4561096) at 180 Volts for ∼30 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The primer sequences for detecting ACTB are 5’-GACCTGACTGACTACCTCAT-3’(forward) and 5’-TCTCCTTAATGTCACGCACG-3’ (reverse) Quantitative PCR (qPCR) reactions were conducted using the SYBR green PCR master mix (Bio-Rad, 1725121) in CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Developmental Biology 2022Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Nuclear and cytosolic fractions of iPSCs-differentiated cells were acquired using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific #78833 ...
-
bioRxiv - Neuroscience 2023Quote: ... membranes were subsequently blocked for 2 h at room temperature with 5% non-fat milk (Bio-Rad, Hercules, CA, USA) or 5% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Protein samples were loaded on 4-15% polyacrylamide gels (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... Digested DNA was purified and 2–5 μg of DNA was run on a 1% PFGE agarose gel (Bio-Rad) in 0.5 × TBE buffer using the CHEF-DRII system (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of mixed primers containing 5 μM of each primer and 5 μl of iTaq Universal SYBR Green Supermix (BioRad), as previously described (Xavier et al. ...
-
bioRxiv - Genomics 2024Quote: To investigate the presence of SRY in Brutus a PCR using primers specific for canine SRY (Forward: 5’ AAGGCCACGGCACAGAAAAGTCAC and Reverse: 5’ AAGAAGCGTCAGCGGACATCTGTG from (19) was performed using iProof HF Master Mix (BioRAD). Amplification was carried out in 25 μL reactions with 1 × PCR MasterMix ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µL primer 556R (5’ CTTTACGCCCARTRAWTCCG 3’) at 10 µM and 10 µL SYBER® Green Master Mix (Bio-Rad, Veenendaal, The Netherlands). The DNA extraction estimated an average rRNA yield corresponding to 5×10^8 bacterial cells/mL.
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Biochemistry 2022Quote: ... with ImageLab Version 5 (Bio-Rad, Hercules, CA). Each experiment has three independent repeats.
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of Sosofast Eva Green (Bio-Rad) 2X master mix ...
-
bioRxiv - Developmental Biology 2023Quote: ... Non-denaturing 5% polyacrylamide 1xTBE Criterion gels (BioRad) were pre-run 30 minutes before loading the reactions.
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% (w/v) NFDM (Biorad, cat no: 1706404) blocking was also performed for each antibody ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% non-fat milk (Bio-Rad) in TBST and incubated in primary antibodies (1:5000 rabbit anti-GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µl precision melt supermix (Bio-Rad, Germany) and 1 µl DNA was used for real-time PCR ...
-
bioRxiv - Immunology 2024Quote: ... then blocked with 5% blocking protein (Bio-Rad) for 1.5h at 37°C and washed four times again ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μL of SYBR Green mix (Bio-Rad) and 0.9 μL of RNase-DNase free water (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were then diluted 1:10 and 2 µL of diluted cDNA were used for RT-qPCR along with 5 µL of iTaq universal SYBR mix (Bio-Rad), 1.5 µL of primers (1.5 µM mix of forward and reverse ...