Labshake search
Citations for Bio-Rad :
151 - 200 of 2497 citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Bio-Beads SM-2 (BIO-RAD) where added to the mixture to remove detergent ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 10% 2-Mercaptoethanol (Bio-Rad). After boiling at 95°C for 5 minutes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of mixed primers containing 5 μM of each primer and 5 μl of iTaq Universal SYBR Green Supermix (BioRad), as previously described (Xavier et al. ...
-
bioRxiv - Genomics 2024Quote: To investigate the presence of SRY in Brutus a PCR using primers specific for canine SRY (Forward: 5’ AAGGCCACGGCACAGAAAAGTCAC and Reverse: 5’ AAGAAGCGTCAGCGGACATCTGTG from (19) was performed using iProof HF Master Mix (BioRAD). Amplification was carried out in 25 μL reactions with 1 × PCR MasterMix ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Biochemistry 2022Quote: ... with ImageLab Version 5 (Bio-Rad, Hercules, CA). Each experiment has three independent repeats.
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of Sosofast Eva Green (Bio-Rad) 2X master mix ...
-
bioRxiv - Developmental Biology 2023Quote: ... Non-denaturing 5% polyacrylamide 1xTBE Criterion gels (BioRad) were pre-run 30 minutes before loading the reactions.
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% (w/v) NFDM (Biorad, cat no: 1706404) blocking was also performed for each antibody ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% non-fat milk (Bio-Rad) in TBST and incubated in primary antibodies (1:5000 rabbit anti-GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µl precision melt supermix (Bio-Rad, Germany) and 1 µl DNA was used for real-time PCR ...
-
bioRxiv - Immunology 2024Quote: ... then blocked with 5% blocking protein (Bio-Rad) for 1.5h at 37°C and washed four times again ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μL of SYBR Green mix (Bio-Rad) and 0.9 μL of RNase-DNase free water (Promega ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL diluted cDNA (5 ng) in a total volume of 5 μL using a CFX384 Real-Time System (Bio-Rad). For each experimental sample (four source colonies ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Biophysics 2022Quote: ... After boiling the beads at 95°C for 5 min in 2X Laemmli sample buffer with 5% β-mercaptoethanol (Bio-Rad), the immunoprecipitated protein was resolved on 10% SDS-PAGE gels and then transferred onto 0.45 μm PVDF membrane (GE ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed 5 X 5 min in TBST and signals were detected using the Clarity Western ECL Substrate (Biorad #1705060). At least 2 separate gels were immunoblotted with cortical extracts from independent litters and used for quantitation.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed by mixing 5 μl of 5-times diluted cDNA with 10 μl of iTaq Universal SYBR Green mix (Bio-Rad), 3.6 μl of water and 0.8 μl of forward and reverse primers listed in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
Self-assembled DNA-collagen bioactive scaffolds promote cellular uptake and neuronal differentiationbioRxiv - Bioengineering 2024Quote: ... The macrostructure was assembled by heating the primers at 95 °C for 30 min and then cooling them to 5 °C with a step decrease of 5 °C every 15 min using a PCR instrument (BioRad, USA). The resulting macrostructure was then stored at 4 °C until required ...
-
bioRxiv - Immunology 2024Quote: Organoids and Mode-K cells were incubated at 37°C with 5% CO₂ in culture media supplemented with 5 µg/mL PureBlu Hoechst (Bio-Rad) and 5 µg/mL Propidium Iodide ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA primers for PMS2 (5’ATAACGTGAGCTCCCCAGAA; 5’ GAGGACCAGGCAATCTTTGA) and ACTIN (5’GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT) were used to amplify target mRNA using iTaq Universal SYBR Green (Biorad, 1725120) and quantified on (Biorad CRX Connect Real-Time PCR Detection System ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then washed five times in 5% TBST (5 minutes each) and incubated with goat anti-mouse IgG secondary antibody (PCS 1706516, Bio-Rad) at a 1:3000 dilution in 5% milk powder in TBST for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... one aliquot of Amberlite XAD-2 (BioRad) was added and allowed to incubate for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... Bio-Beads SM-2 Adsorbents from Biorad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 50 mg of Biobeads SM-2 (BioRad) were added to remove detergent and promote protein insertion into liposomes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... containing 2 g Chelex-100 resin (BioRad) to remove divalent metals ...
-
bioRxiv - Biophysics 2021Quote: ... and 2 μL β-mercaptoethanol (Bio-Rad) were added to 30 μL of sample ...