Labshake search
Citations for Bio-Rad :
51 - 100 of 2497 citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Microbiology 2024Quote: ... 1 % 2-Mercaptoethanol (Biorad)) and bead beat for 2 minutes at maximum speed (Biospec Mini Beadbeater) ...
-
bioRxiv - Cell Biology 2021Quote: ... TGF-β1 (5 ng/mL, BioRad), or a combination of DEX (10-6M ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% non-fat milk (Bio-Rad) was used as the blocking agent for primary antibodies detecting non-phosphorylated proteins and all horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam ...
-
What challenges remain in harmonizing cytomegalovirus viral load quantification across laboratories?bioRxiv - Microbiology 2024Quote: ... (iv) 5 duplicates from Bio-Rad’s Exact Diagnostics Verification Panel 1.4 mL (CMVP200 ...
-
bioRxiv - Cell Biology 2024Quote: ... blocked in 5% milk (1706404, BioRad) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... C) 5’-CTTCAAGGAGGACTGCCAC & and 5’-TGGGGTAGGTGCCGAAGT) and target concentration was determined using QuantaSoft Software™ (Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Immunology 2022Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Genomics 2020Quote: ... + 2 μl SilentFect (Bio-Rad) was incubated at RT for 5 min before mixing with 2 μl siRNA (20 μM stock ...
-
bioRxiv - Cell Biology 2020Quote: ... 2× loading buffer (Biorad, 1610768) was added to hairpin samples ...
-
bioRxiv - Microbiology 2020Quote: ... and 2-mercaptoethanol (Bio-Rad), heated at 100°C for 5 minutes ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... and MOMA-2 (Bio-Rad). Plaque size was analyzed by ORO staining to provide contrast ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mm cuvette (Bio-Rad). The mixture was recovered for 2-3 h in 1 mL of NB medium at 28℃ and then cultured for 2 h after adding aTc to a final concentration of 200 μg/mL ...
-
bioRxiv - Genomics 2023Quote: ... 0.128mM 2-Mercaptoethanol (BioRad 1610710XTU), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF) ...
-
bioRxiv - Microbiology 2022Quote: ... + 2-mercaptoethanol (Bio-Rad #1610710) directly to the cell monolayer followed by incubation at 95°C for 15 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... 2% bis-acrylamide (Bio-Rad), and fluorescent beads (yellow or Texas red with ~0.5 μm diameter ...
-
bioRxiv - Molecular Biology 2024Quote: ... + 2 µl SilentFect (Bio-Rad) was incubated at room temperature (RT ...
-
bioRxiv - Genomics 2024Quote: ... 2% (Bio-Rad, 161-0142); Ammonium persulfate (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... Biobeads SM-2 (Bio-Rad) were hydrated by washing them once in methanol ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2× Laemilli Buffer (Biorad). Lysates were heated for 5 min at 96 °C and resolved on an 8–10% SDS-acrylamide gel (Invitrogen) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the membrane blots were blocked in 5% blocking buffer (5% non-fat dry milk, Bio-Rad, in TBST) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad) for 1 hour at room temp ...
-
bioRxiv - Neuroscience 2020Quote: ... Blocking solution contained 5% milk powder (BioRad) in Tris-buffered saline containing 0.2% Tween 20 ...
-
bioRxiv - Microbiology 2021Quote: ... resolved by 5% TBE gel (Bio-Rad), and visualized using an Odyssey infrared imager (LI-COR Biosciences).