Labshake search
Citations for Bio-Rad :
151 - 200 of 2464 citations for 7 Deaza 2' deoxyadenosine 5' O monophosphate 7 CH 5' dAMP dTuMP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... containing 5% β-mercaptoethanol (Bio-Rad, 1610710), boiled for 5 minutes at 95°C and loaded onto Mini-Protean TGX Stain Free Gels 4-20% (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... + 5 % βmercapto-ethanol (BioRad ref #161-0710), and heated for 5 min at 70°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-phospho-p38 MAPK (Thr180/Tyr182 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% blotting grade blocker (Bio-Rad, 1706404XTU). The primary antibodies used are listed in Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantum™ FITC-5 MESF beads (BioRad) were used according to the manufacturer’s protocol to estimate the length of telomeres quantitatively ...
-
bioRxiv - Microbiology 2023Quote: ... After blocking with 5% BSA (BIO-RAD) in 1 X PBS at room temperature for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% blocking protein (Bio-Rad) at 37°C for 1 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... 30 second at 72°C and a final extension of 7 minutes at 72 °C in a thermal cycler (T100TM Thermal Cycler, Bio-Rad). Five μl of PCR product was visualized on a non-denaturing 1% agarose gel with a 100bp ladder ...
-
bioRxiv - Neuroscience 2021Quote: ... 40 min) and were subsequently transferred to nitrocellulose membranes for semi-dry immunoblotting (25 V, 1,3 A, 7 min, Bio-Rad®). Membranes were dried 5 min at 37°C and then incubated with 5% non-fat dried milk in Tris-buffered salineTween-20® (TBST containing 28 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: Two micrograms of each RNA sample was loaded on 10% polyacrylamide gels containing 7 M urea or loaded onto 10% Criterion TBE-urea precast gels (Bio-Rad) and electrophoresed at 85 V ...
-
bioRxiv - Pathology 2021Quote: ... Real-time PCR was performed on a QuantStudio 7 Flex Real-Time PCR System (Thermo-Fisher) using the iTaq Universal SYBR green Supermix (Bio-Rad). The following primer sequences were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20-30 μg of total protein was resolved on 8-16% TGX stain-free gels and transferred onto nitrocellulose membrane using the Trans-Blot Turbo RTA Transfer kit and the Trans-Blot Turbo Transfer system set to 7 min transfer protocol (all from Bio-Rad). Stain-free gel and blots were imaged using the Gel Doc EZ imaging system (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were transferred electrophoretically at a constant voltage of 25 V for 7 min using a Trans-Blot Turbo Transfer System (Bio-Rad). After transfer ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were incubated at 30 °C for 7 days and imaged daily using a gel documentation system (Gel Doc™ XR+, BIORAD). When needed ...
-
bioRxiv - Biochemistry 2020Quote: ... the buffer of the purified DNAJB6 was exchanged into 10 mM ammonium acetate pH 7 solution using Micro Biospin P6 centrifuge columns (Bio-Rad) and protein concentration determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific ...
-
Modifications in the T arm of tRNA globally determine tRNA maturation, function and cellular fitnessbioRxiv - Molecular Biology 2023Quote: ... RNA was transferred to a nylon membrane (Amersham Hybond-XL) at 23 V for 7 minutes using a Trans-Blot Turbo Transfer System (Bio-Rad). Following transfer ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were resolved on 7-15% gradient polyacrylamide (SDS-PAGE) gels and transferred to nitrocellulose membranes via Trans Blot Turbo (Bio-Rad). Membranes were then blocked with 5% milk in Tris-buffered saline and 0.05% Tween 20 (TBST ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was loaded onto 8 to 12% PAGE–7 M urea gels and transferred to Hybond-N+ (GE) membranes using a Trans-Blot Turbo Transfer system (Bio-Rad) in 1X TBE ...
-
bioRxiv - Microbiology 2021Quote: ... were confirmed positives by tests performed in slide agglutination using Salmonella O Poly Antisera (anti-O – Bio-Rad, USA).
-
bioRxiv - Developmental Biology 2022Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Nuclear and cytosolic fractions of iPSCs-differentiated cells were acquired using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific #78833 ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... membranes were subsequently blocked for 2 h at room temperature with 5% non-fat milk (Bio-Rad, Hercules, CA, USA) or 5% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Protein samples were loaded on 4-15% polyacrylamide gels (BioRad ...
-
bioRxiv - Biophysics 2020Quote: ... 50 µl of a 10− 6 M biotinylated and 10−7 M dye-coupled oligonucleotide solution were co-incubated to anneal the oligonucleotides at 80 °C using a Thermocycler (BioRad, C1000 ThermoCycler), followed by sample cooling to 4 °C with -1 °C/min ...
-
bioRxiv - Immunology 2021Quote: ... The cells were centrifuged at 300G for 7 minutes at 4°C and the cell pellet was resuspended then counted with the BioRad cell counter (Bio-Rad, TC20).
-
bioRxiv - Neuroscience 2021Quote: ... Lcn2 and C3 were quantified by quantitative real-time PCR (qRT-PCR) using the QuantStudio 7 Pro System thermo-cycler (ThermoFischer Scientific) and SYBR Green Master Mix (Bio-Rad Laboratories). Data are shown as fold change relative to control samples using the ΔΔCq method with Rpl4 as an internal control gene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative real-time PCR was performed with the Applied Biosystems ViiA 7 system using iTaq Universal SYBR Green Supermix (Bio-rad #1725121). Human actin was used as a house keeping control ...
-
bioRxiv - Cell Biology 2022Quote: ... To verify the generation of single chain antibodies we prepared samples of whole and reduced antibodies with NuPAGE LDS Sample Buffer (4x) and run them in NuPAGE™ 7% Tris-Acetate Protein Gels (Bio-Rad) in denaturing ...
-
bioRxiv - Genomics 2019Quote: ... Resulting single-cell GEMs were collected at the completion of the run (~7 min) and linear amplification was performed in a C1000 Touch Thermal cycler with 96-Deep Well Reaction Module (Bio-Rad; 1851197): 72°C for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and image captured by continuous exposure for 7 minutes with a Bio-Rad ChemiDoc MP Imaging System (12003154, Bio-Rad, CA, USA). The protein expression was quantified by determining individual band density using ImageJ (FIJI ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Membranes were washed 5 time for 5 minutes with PBST and incubated with horseradish peroxidase (HRP) conjugated secondary antibodies (Biorad) for 2 hours at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Plant Biology 2019Quote: 5 % Mini-PROTEAN TBE precast gels (Bio-Rad) have been pre-electrophoresed in 0.5x TBE buffer for 60 minutes at 70 V ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... loaded onto a 5% polyacrylamideTBE gel (Bio-Rad) that had been pre-run for 15 minutes in TB Buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... in 5% powdered milk (Bio-Rad 170-6404) resuspended in 1x TBST ...
-
bioRxiv - Genomics 2019Quote: ... Blocked membrane in 5% Blotting-Grade Blocker (BioRad) in TBS-T (50 mM Tris pH 7.6 ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...