Labshake search
Citations for Bio-Rad :
51 - 100 of 2464 citations for 7 Deaza 2' deoxyadenosine 5' O monophosphate 7 CH 5' dAMP dTuMP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: GAGs were purified with a column of 7 mm diameter and 10 cm length (BioRad) packed with Sephadex G25 resin (Sigma-Aldrich # G25150) ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Plant Biology 2023Quote: ... Each reaction contained 5 μL of 2 x iQ SYBR Green supermix (Bio-Rad), 2 μL of diluted cDNA (10 times dilution for shoots and roots ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µg of each extract was loaded on 7-12% precast SDS-polyacrylamide gels (Bio-Rad). After transference ...
-
bioRxiv - Microbiology 2019Quote: ... For WB proteins were transferred (25 V, 1.3 A, 7 min) onto nitrocellulose membranes (Bio-Rad) using Bio-Rad Trans Blot Turbo Transfer system ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7) for 30 min to 1 hr then assembled in a dot blot apparatus (BioRad). After washing with 100 μl TE buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were resolved on 7 cm pH 3-10 immobilized pH-gradient (IPG) strips (Bio-Rad), under mineral oil ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted using a 20:7:3 mixture of buffer: 4x Laemmli sample buffer (Biorad):10x NuPage sample reducing agent (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... 7 μL RNase-free water and 10 μL iQ SYBR○R Green Supermix (Bio-Rad, USA). The standard curves were constructed from a series of 10-fold dilutions of a plasmid DNA obtained by TOPO TA cloning (ThermoFisher ...
-
bioRxiv - Physiology 2023Quote: ... Standard SDS-PAGE was performed with BioRad 7-12% TGX gels (4561086; BioRad, Hercules, CA, USA) and polyvinylidine difluoride (PVDF ...
-
bioRxiv - Plant Biology 2024Quote: ... consisting of 7 μL Sso Advanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 0.28 μL of each primer (10 μM) ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: 2-10ug of RNA extractions were loaded into a 5% acrylamide (Bio-Rad Laboratories: 1610156), 0.5x TBE (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction products were resolved on 15% denaturing PAGE gel with 7 M Urea (Bio-Rad #3450091), and was exposed to a phosphor screen (Amersham ...
-
bioRxiv - Microbiology 2021Quote: ... and final extension at 72°C for 7 min using a C1000 Touch Thermal Cycle (BIO-RAD). PCR results were run on 1% agarose gels and imaged using an iBright CL1500 Imaging system (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad) for passive rehydration overnight at 20 °C in a Protean IEF Cell equipment (BioRad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 7 min with a constant 2.5 A using a Trans-Blot Turbo transfer system (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... for 7 minutes and separated with 4-20% Mini-PROTEAN TGX protein Gel (Bio-Rad, Cat # 5671094), transferred to nitrocellulose membranes according to standard protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 7 µg of each cell extract was loaded on a 12% stain-free SDS-PAGE gel (BioRad) and separated by gel electrophoresis at 175 V for 45 min ...
-
bioRxiv - Molecular Biology 2023Quote: The WB samples were loaded on a 4-20% or 7% Midi CriterionTM TGXTM Precast gel (BioRad) and ran at 180V for 45min in 1x running buffer (190mM glycine ...
-
bioRxiv - Biophysics 2023Quote: Apoptosis was probed using the Bio-Rad Magic Red Caspase 3-7 kit (Bio-Rad, ICT 935). HEK 293T cells stably expressing FGFR1-YFP were seeded in 96 well plates and allowed to grow to ∼70% confluency ...
-
bioRxiv - Neuroscience 2024Quote: ... and heated at 95°C for 7 min prior to separation by 10% SDS-PAGE (BioRad Laboratories). Following electrophoresis ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a 1:5 w/w ratio for 2 hours before addition of 100 mg mL-1 Bio-Beads SM-2 resin (Bio-Rad) and then incubated overnight at 4 °C with gentle agitation to remove detergent ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture was then treated with 5% volume of Bio-Bead SM-2 resin (Bio-Rad) with shaking on ice for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% of the lysates were boiled with 2 x laemmli buffer (BIO-RAD, Hercules, CA, USA) and used as input ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl HF buffer (BioRad), 5 µl combinational enhancer solution (2.7 M betaine ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.01% CHS) on a NGC system (Bio-Rad, Hercules, CA). The peak fractions were collected and spin concentrated for reconstitution.
-
bioRxiv - Biochemistry 2021Quote: ... 0.005% CHS) on a NGC system (Bio-Rad, Hercules, CA). The peak fractions were collected ...
-
bioRxiv - Cell Biology 2020Quote: ... and the slices were transfected at 4 – 7 days in vitro using a Helios gene gun (Bio-Rad). Slices were examined at 1 – 2 weeks post-transfection.
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... immobilized pH gradient (IPG) strips of 18 cm having a pH range 4-7 (Ready Strips, Bio-Rad) were used and were rehydrated overnight at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 7) and Western blotting samples were prepared by adding sample buffer (3× Laemmli Sample Buffer 1610747; BioRad) plus 3.57 M β-mercaptoethanol (2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Microbiology 2019Quote: ... Relative fluorescence was measured at 5-minute intervals for 2 hours in a CFX96 system (Bio-Rad).
-
bioRxiv - Developmental Biology 2019Quote: ... 2 μl of gene-specific primer pair and 5 μl iTaq Universal SYBR Green Supermix (Bio-Rad). The relative transcript abundance of each gene (normalized to rpl4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 μl cDNA (diluted 1:5) using a CFX384 real-time system qRT-PCR machine (BioRad). Primers were designed using Benchling and purchased from Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of diluted vRNP mixtures was loaded onto a 5% polyacrylamide native TBE gel (Bio-Rad) and run at 125 V for 80 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed in 7 min at 1.3 A and 25 V using a Trans-Blot TurboTM transfer system (BioRad). Recognition and revelation of the his-tagged protein was performed as described for the Dot Blot ...
-
bioRxiv - Neuroscience 2019Quote: ... “any kD” (to quantify GDNF protein) or 7% (to quantify CBP) precast polyacrylamide gel (Bio-rad, Hercules, Cal, USA) and transferred to a polyvinylidene difluoride membrane (PVDF ...
-
bioRxiv - Microbiology 2020Quote: ... in 0.5×TBE buffer at 4 to 7 °C for 260 h using a CHEF Mapper System (Bio-Rad). Switching time was 1,200 to 4,800 s at 1.5 V/cm with an included angle of 120° ...
-
bioRxiv - Molecular Biology 2022Quote: ... LarA extracted from a 7 cm prep well Mini-PROTEAN® TGX Stain-Free™ gel (#4568091, Bio-Rad) was used for affinity purification of the final antibody.
-
bioRxiv - Synthetic Biology 2022Quote: ... The reaction was run for 7 h at 34 °C on a CFX96 real-time PCR detection system (Biorad) and monitored thanks to the SYBR Green II signal.
-
bioRxiv - Biochemistry 2023Quote: ... The gels were then transferred to a water-activated nitrocellulose membrane at 1.3A to 25V for 7 minutes (BioRad TurboBlotter ...