Labshake search
Citations for Bio-Rad :
151 - 200 of 747 citations for 6 Chloro 2H chromene 3 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membranes were blocked with 3% nonfat dry milk (BioRad 1706404) in 1X PBST for 30 min at room temperature and incubated with the GAPDH antibody (Cell Signaling Technology 2118 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Developmental Biology 2019Quote: ... and loaded on a 3-8% tris-acetate gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Microbiology 2019Quote: ... After washing the plate 3× (MAG3× setting on BioRad wash station) with wash buffer (PBS with 0.05% Tween20) ...
-
bioRxiv - Cell Biology 2019Quote: ... and loaded onto 3-8% Tris-acetate gels (Bio-rad, #3450131). Purified bovine 19S (UBPbio ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Cell Biology 2022Quote: ... at 400 mA for 3 hours using a MiniTransblot Module (BioRad). After protein transfer ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 3:1 with 4x Laemmli buffer (Biorad, cat. no. 1610747) containing β-mercaptoethanol and heated at 95°C for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 3-10 ReadyStrip IPG Strips (Bio-Rad, Hercules, CA, USA) at 50 μA per strip at 20 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 trans-blot papers (Bio-Dot SF Filter Paper, Bio-Rad, #1620161) and one cellulose acetate membrane (Cellulose Acetate Membrane Filters ...
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times with 0.1% Tween-20 (Bio-Rad,1706531) TBS (TBTS-T ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and anti-F4/80 FITC (3:100, Bio-Rad Laboratories, Temse, Belgium). The single cells were washed with 1XPBS+1%FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then washed again 3 times before revelation by electrochemoluminescence (Bio-Rad) using the Chemi-doc XRS+ (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... After 3 washes with 0.05% Tween 20 (catalog number 1706531, Bio-Rad) in PBS (TPBS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... to 3 mL for buffer exchange with an Econo10 DG column (Biorad) equilibrated in buffer A and eluted with 4 mL of the same buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Cancer Biology 2024Quote: ... using a Mini PREOTEAN 3 cell (525BR058974; Bio-Rad, Hercules, CA, USA) and PowerPac™ Power Supply (043BR09142 ...