Labshake search
Citations for Bio-Rad :
101 - 150 of 326 citations for Recombinant Human Fc Fragment Of LgG Receptor Transporter Alpha since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Following PCR amplification of pooled fragment libraries with a proofreading polymerase (Iproof; BioRad, Hercules CA), fragments ranging from 350 to 450 base pairs (bp ...
-
bioRxiv - Genetics 2019Quote: ... Desired fragments were amplified using a C1000 Touch Thermal Cycler (Bio-Rad, Inc., Hercules, CA).
-
bioRxiv - Biochemistry 2023Quote: ... and the size of the fragments evaluated by running a protein standard ladder (Bio-Rad). The Fab bands were cut and reduced by 10 mM TCEP at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... and the size of the fragments evaluated by running a protein standard ladder (Bio-rad). The Fab bands were cut and reduced by 10 mM TCEP at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... The enrichment of obtained chromatin fragments was estimated using qPCR (BioRad CFX96 Real-Time machine) using specific primers targeting specific and non-specific (negative control ...
-
bioRxiv - Biochemistry 2022Quote: ... The αM and β2 subunits of recombinant Mac-1 integrin were resolved on 4-20% polyacrylamide (BioRad), gradient gels by SDS-PAGE and stained with Coomassie brilliant blue R250 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel carrying the recombinant proteins and their derivatives was eventually stained with Coomassie Blue (Bio-Rad) for 1 hour and was de-stained with a de-staining solution (20% methanol and 10% acetic acid in water).
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Digested DNA fragments were then subjected to 1% agarose pulsed-field gel electrophoresis (PFGE) (Bio-Rad) using 0.5% Tris/Borate/EDTA (TBE ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR-fragments were produced on a C1000 Thermal Cycler (Bio-Rad, Hercules, CA, USA Cat#1851148) using Phusion-Polymerase (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Fragments were delivered to candidate KN99ɑ and KN99a cultures via biolistic delivery (Bio-Rad PDS-1000). Deletion candidates (from at least two independent transformations ...
-
bioRxiv - Genetics 2024Quote: ... The digested fragments were fractionated and collected using CHEF Mapper pulsed field gel electrophoresis (Bio-Rad). The extracted DNA fragments were ligated to the pBeloBAC11 vector ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant protein purities were assessed by SDS-PAGE using 4-20% Mini-Protean TGX gels (Bio-Rad, #4561094) and quantified using the BCA Protein Estimation kit (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: Marchantia thallus fragments were placed into a PDS-1000 / He Biolistic® Particle Delivery System (Bio-Rad). A vacuum of 25 in Hg vac was applied and the DNA-coated gold particles were shot at 900 psi from a distance of 10 cm ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA synthesis of purified mRNA fragment was carried out using the iScript cDNA Synthesis Kit (Bio-Rad) as instructed ...
-
bioRxiv - Biophysics 2022Quote: ... The DNA fragments were visualized in a Gel Doc XR+ Gel Documentation System (Bio-Rad, Mississauga, Canada) and photographed.
-
bioRxiv - Molecular Biology 2021Quote: ... Only fragments with successful double ligation were exponentially amplified within the QX200 ddPCR EvaGreen Supermix (Bio-Rad). Varying DNA inputs into LC (3ng ...
-
bioRxiv - Genomics 2020Quote: ... the size of DNA fragments was evaluated using the CHEF Mapper electrophoresis system (Bio-Rad Laboratories, California). Genomic DNA (16 μg ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and the fragment size (≤ 400 kb) was determined using the CHEF Mapper electrophoresis system (Bio-Rad Laboratories). Fragments < 25 kb were removed using the Short Reads Eliminator kit (Circulomics ...
-
bioRxiv - Immunology 2020Quote: ... a total of 6 × 107 cells was incubated in staining buffer with mouse anti-pig CD4 alpha (clone MIL17, Bio-Rad AbD Serotec, Puchheim, Germany, 1:50) at 4°C for 20 min ...
-
bioRxiv - Immunology 2019Quote: ... After quantifying the optimal virus-to-erythrocyte concentration (4HA units), serial two-fold dilutions of Fc, control IVIG (GammaGard, Baxter Healthcare) and polyclonal goat anti-influenza B (Biorad) were prepared ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... His-tagged recombinant protein was purified using Ni-NTA purification with the help of Ni-charged resins (Bio-Rad). Purified protein was further used for kinase assay ...
-
bioRxiv - Immunology 2022Quote: ... we amplified cDNA fragments and proceeded with qPCR reactions on CFX96 Thermal Cycler Real Time System (Bio-Rad). The reactions were normalized to 3 housekeeping genes (Gapdh ...
-
bioRxiv - Immunology 2022Quote: ... we amplified cDNA fragments and proceeded with qPCR reactions on CFX96 Thermal Cycler Real Time System (Bio-Rad). The reactions were normalized to 3 housekeeping genes (Gapdh ...
-
bioRxiv - Plant Biology 2022Quote: ... and the genomic fragments were amplified with iProof high-fidelity DNA polymerase (Bio-Rad, USA; Cat. No. #1725301). Primer sequences for the GFP cloning are in Supplemental Table 2.
-
bioRxiv - Genetics 2023Quote: ... The copy number of var and control fragments in each well was calculated using QuantaSoft software (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... Imaging was performed using either an Odyssey Fc imaging system (Li-Cor) (quantified using Image StudioTM software) or a Molecular ChemiDocTM Touch Imaging System (Bio-Rad) (quantified using Image Lab 6.0.1 software).
-
bioRxiv - Bioengineering 2019Quote: ... Lysate samples were analysed for recombinant protein expression by SDS PAGE (12% Mini-PROTEAN-TGX stain-free gel; Bio-Rad), using Precision Plus unstained protein ladder (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were analysed by Western Blot using custom-made SLR1 specific polyclonal antibody with Mini-Protean II system (Biorad).
-
bioRxiv - Immunology 2021Quote: ... Recombinant Bovine Interleukin-8 PBP039 and Goat anti Bovine Interleukin-8 Ab conjugated to biotin AHP2817B (all from Bio-Rad, protocol according to the manufacturer’s intructions).
-
bioRxiv - Biophysics 2022Quote: ... 2 μl of recombinant proteins and 1 μl of a molecular weight marker (Precision Plus Protein Kaleidoscope Prestained Protein Standards, BioRad) were applied to the PAGE lane (10 wells ...
-
bioRxiv - Biophysics 2023Quote: The monovalent streptavidin sample was kindly provided by the Howarth Lab (University of Oxford),23 and recombinant IgE Kappa (clone AbD18705_IgE, Cat#HCA190) was purchased from Bio-Rad Laboratories.