Labshake search
Citations for Bio-Rad :
101 - 150 of 506 citations for IL 8 CXCL8 Human 77a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... avara pased the quality checks (i.e., RIN > 8 in Experion, Bio-Rad, USA). In short ...
-
bioRxiv - Cancer Biology 2024Quote: SDS-PAGE Gels (8% or 10%) were transferred to nitrocellulose membranes (Bio-Rad) using a Trans-blot apparatus (2.5 A constant ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentrations were determined with the Bradford quantification assay (Bio-Rad Laboratories, Des Plaines, IL, USA), using BSA (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were determined using a Micro Bradford Protein Assay Kit (Bio-Rad, Rockford, IL, USA). Samples with equal quantities of protein (50 μg ...
-
bioRxiv - Developmental Biology 2021Quote: Proteins from each sample were resolved using a precast 8-16% gradient gel (Biorad), and transferred to a PVDF membrane following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Products were detected by running an 8% acrylamide gel (19:1 acrylamide:bisacrylamide) (Bio-Rad), 1X TBE ...
-
bioRxiv - Genomics 2020Quote: Lysates were separated by SDS-PAGE on 3-8% Tris-acetate gels (BioRad #3450129) for 2.5 hours at 150V ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and cryostat sections (8 mm) were stained using rabbit anti-FITC (BioRad; 4510-780) and rat anti-CD31 (BD Biosciences ...
-
bioRxiv - Bioengineering 2021Quote: ... Bio-Plex Pro Mouse Cytokine 8-plex Assay kit (#M60000007A) (Bio-Rad, Hercules, CA).
-
bioRxiv - Biochemistry 2022Quote: ... The SDS-PAGE gel used weas a pre-cast 8-16 % gradient (Bio-Rad) and initially stained using Pro-Q™ Emerald 300 glycoprotein staining kit to highlight glycoproteins and subsequently stained with coomassie to visualise total protein ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on 8–16% Mini-PROTEAN® TGX Precast gels (Bio-Rad) and transferred onto 0.2 µm nitrocellulose membrane (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... and equal amounts were separated by 4–15% or 8–16% SDS-PAGE (BioRad) and blotted onto polyvinylidene fluoride (PVDF ...
-
bioRxiv - Immunology 2020Quote: ... pH 8) and eluted by boiling the samples for Laemmli sample buffer (Bio-Rad). Eluates were collected from the beads by centrifugation and resolved on a NUPAGE 4-12 % Bis-Tris gel (Invitrogen).
-
bioRxiv - Cancer Biology 2021Quote: ... 25ug of sample was loaded per well on 8-12% Bis-Tris gels (BioRad) and run for 2.5h/100V ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on gradient 8-16% Mini-Protean TGX precast gels (Bio-Rad) and transferred onto 0.45 μm pore nitrocellulose ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified whole cell lysates were run on a 8-16% SDS-PAGE gel (BioRad) and transferred to a nitrocellulose membrane (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... samples were run through Criterion XT Tris-acetate precast gels (3-8% gradient) (Biorad) in a XT tricine buffer (Biorad) ...
-
bioRxiv - Immunology 2023Quote: ... The lysates were separated by 8-16% pre-cast SDS-PAGE gels (Bio-Rad) and transferred onto PVDF membranes ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein was separated by 8%–12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (Bio-Rad) and blotted on polyvinylidene difluoride membrane (Merck Millipore) ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on 8–16 % Mini-PROTEAN® TGX™ Precast gels (Bio-Rad) and transferred onto nitrocellulose membrane ...
-
bioRxiv - Molecular Biology 2019Quote: ... in Tris-glycine-SDS running buffer or 3-8% Criterion XT Tris-acetate gels (BioRad) in Tris-acetate-SDS running buffer ...
-
bioRxiv - Immunology 2019Quote: ... lysates were resolved using precast Mini-PROTEAN TGX gels 8-16% gradient gels (Bio-Rad) and transferred to nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were separated in 8–12% SDS-PAGE and transferred to a nitrocellulose membrane (BioRad). The membrane was blocked in 5% milk ...
-
bioRxiv - Immunology 2020Quote: ... Samples were separated on 8–16 % Mini-PROTEAN® TGX™ Precast gels (Bio-Rad) and transferred onto nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked 10 min with 8% (w/v) non-fat dry milk (Bio-Rad) in Tris-buffered saline (TBS)-T and stained with primary antibodies (listed in material section ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were separated on 8–16 % Mini-PROTEAN® TGX™ Precast gels (Bio-Rad) and transferred onto nitrocellulose membrane ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The cultures were dispensed in 100 μL aliquots into 8-well PCR strips (Bio-Rad) and incubated for 24 h in a thermal gradient using a DNA Engine Tetrad 2 Peltier Thermal Cycler (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... The products were analyzed by 8% acrylamide/bis-acrylamide (19:1 ratio, Bio-Rad, 1610145) gel containing 1x TBE and 7M Urea ...
-
bioRxiv - Cell Biology 2023Quote: ... 20μg protein was isolated on 8-10% SDS-PAGE and transferred to nitrocellulose membrane (BioRAD). Nonspecific binding was blocked by incubation of membranes with 10% (W/V ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 0.2 ml Flat PCR Tube 8-Cap Strips (Bio-Rad™, optical, ultraclear, #TCS0803). Optimum amplification conditions were determined for each by amplifying six concentrations of a 5× dilution series of MG1655 pJK14-Tn4rev pZA31-mCherry-tnpB using two-step amplification with a thermal gradient of 55–75°C ...