Labshake search
Citations for Bio-Rad :
101 - 150 of 8299 citations for 7 Bromo 3 4 dihydro 1H benzo e 1 4 diazepine 2 5 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were blocked overnight at 4°C in PBS with 3% BSA and 10% donkey serum (Bio-Rad), stained with DAPI (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... The mixture was kept for 5 min at 95°C and 5 min on ice before loading on a TGX 4-20% Strainfree (Bio-Rad US) gel immersed in TGS 1X buffer ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Neuroscience 2021Quote: ... with primers listed in Table 4-1 on a CFX96 system (BioRad). Thermocycler conditions were 95°C for 3 min followed by 40 cycles of 95°C for 10 sec and 55°C for 30 sec ...
-
bioRxiv - Cancer Biology 2022Quote: ... was added to a 1:4 mixture of Laemmli Sample Buffer (BioRad) and 2- Mercaptoethanol (BioRad ...
-
bioRxiv - Biophysics 2023Quote: ... detergent was removed after 4 h of incubation with Bio-Beads SM-2 (Bio-Rad, USA) pre-equilibrated with the reconstitution buffer ...
-
bioRxiv - Immunology 2023Quote: ... with 10 % 2-Mercaptoethanol and loaded onto 4-20% precast polyacrylamide gels (4561096, 5671095; Bio-Rad). Imaging was performed with enhanced chemiluminescent detection (34096 ...
-
bioRxiv - Genetics 2024Quote: ... 4 mg/ml lyticase) and blended with 300 μl of 2% low-melt agarose (Bio-Rad). Then ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Immunology 2021Quote: ... Basically 300 ug of IVIG protein were subjected to isoelectric focusing (IPG) across pH gradients of 4-7 (Biorad, LifeSciences, Hercules, Ca, USA) or pH 6-11 (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... which then heated at 90°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... Denatured protein lysates (5 μg) were loaded in 4–20% Criterion TGX Precast Gels (Bio-Rad, 5678095) and transferred to Immobilon-FL PVDF membrane (0.45 μm pore ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated overnight at 4°C with primary antibodies dissolved in 5% Blotting-Grade Blocker (Bio-Rad). All primary antibodies and dilutions used are listed in Supplementary Table STm.1 ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... boiled for 5 min and loaded on a 4-15% Criterion TGX Stain-Free precast gel (BioRad). Protein samples were transferred unto a PVDF membrane (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... All samples were acquired on a ZE5 5-laser or 4-laser cell analyzer (Bio-rad laboratories) and analyzed with FlowJo software (Tree Star) ...
-
bioRxiv - Genomics 2023Quote: ... 10% glycerol) containing 5% ß-mercaptoethanol before SDS-PAGE on a 4-15% polyacrylamide gel (Bio-Rad). Proteins were transferred onto a nitrocellulose membrane blocked with AdvanBlock-Chemi blocking solution (Advansta ...
-
bioRxiv - Biochemistry 2023Quote: mtHsp60V72I (10 μL of 5 μM monomer) was loaded on a 4-15% TGX gel (Bio-Rad), run for 30 min at 200 V ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Microbiology 2019Quote: ... and 3 mg Bromophenol Blue) were separated by SDS-PAGE using 4-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4% CHAPS and deStreak (BIORAD, Australia). Two equilibration steps were carried out in SDS equilibration buffer consisting of SDS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Lastly 4 μl TEMED (Bio-Rad) and 6 μl freshly prepared Ammonium persulfate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 4-20% precast gels (BioRad). Gels were transferred onto Immobilon-P PVDF membrane (EMD Millipore) ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Molecular Biology 2022Quote: ... boiled for 2 min and then analyzed on a 4–20 % SDS-PAGE gradient gels (Bio-Rad). The protein bands were then transferred to a nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2024Quote: ... Detergent removal was carried out at 4°C via incubation with Bio-Beads SM-2 (Bio-Rad) at a concentration of 200 mg ml-1 for three times with two hours for each time ...
-
bioRxiv - Plant Biology 2024Quote: ... centrifuged for 2 minutes before running through 4-20% mini Protean TGX Stain Free Gel (BioRad, USA). The separated proteins were transferred to Immobilon®-P PVDF membrane (Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... or at 100 V for 2 h at 4 °C using the wet transfer method (Bio-Rad Mini Trans-Blot Electrophoretic Cell 170-3930) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1 h at 4°C in a sealed gravity column (Bio-Rad). The beads on the gravity column were washed with 50 ml of high-salt wash buffer (20 mM HEPES ...
-
bioRxiv - Neuroscience 2024Quote: ... consisting of 4% (vol/vol) of 19:1 acrylamide/bis-acrylamide (BioRad, 1610144), 60 mM Tris⋅HCl pH 8 (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... The membranes were incubated overnight at 4°C in blocking solution 5% (w/v) Blotting-Grade Blocker (BioRad) in PBS-Tween buffer (1× PBS ...
-
bioRxiv - Cell Biology 2022Quote: Equal volumes (5 µg) of the prepared co-IPs were separated by SDS-PAGE (4–15%, Bio-Rad) and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Physiology 2019Quote: ... qPCR was performed using Taqman probes for β-actin (assay #Mm02619580_g1) and MMP13 (assay #Mm00439491_m1 which targets exons 4-5) and using iQ SYBR Green Supermix (BioRad) with β-actin as the housekeeping gene (primer sequences given in Supp ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated 5 min at 95 °C and separated on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins could be detected with an infrared imager (Odyssey ...
-
bioRxiv - Molecular Biology 2023Quote: ... heated at 95°C for 5 min then run on a 4-12% Bis-Tris gel (BioRad 3450125). The input sample is identical to the initial solution containing protein in 60 μL 1x selection buffer prior to capture with 20 passages over the ME200 tip ...
-
bioRxiv - Neuroscience 2023Quote: ... with 5% β-Mercaptoethanol then loaded on 4-20% Criterion TGX Precast Midi protein gels (Bio-Rad #5671094). The gels were run in TGS buffer (1x ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...