Labshake search
Citations for Bio-Rad :
101 - 150 of 8842 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Cell Biology 2024Quote: ... 4× Laemmli sample loading buffer (BioRad) was added to the supernatant and the mixture was boiled for 5 mins at 95 °C ...
-
bioRxiv - Microbiology 2024Quote: ... or 4-20% gradient gels (BioRad). Coomassie blue was used to stain gels with recombinant proteins ...
-
bioRxiv - Genetics 2024Quote: ... 4×Laemmli Sample Buffer (Bio-Rad) was added to lysates and samples were denatured at 50°C for 15min (and not boiled to prevent the aggregation of the DMT1 transmembrane protein) ...
-
bioRxiv - Molecular Biology 2022Quote: ... boiled for 2 min and then analyzed on a 4–20 % SDS-PAGE gradient gels (Bio-Rad). The protein bands were then transferred to a nitrocellulose membrane ...
-
bioRxiv - Neuroscience 2024Quote: ... or at 100 V for 2 h at 4 °C using the wet transfer method (Bio-Rad Mini Trans-Blot Electrophoretic Cell 170-3930) ...
-
bioRxiv - Biochemistry 2024Quote: ... Detergent removal was carried out at 4°C via incubation with Bio-Beads SM-2 (Bio-Rad) at a concentration of 200 mg ml-1 for three times with two hours for each time ...
-
bioRxiv - Plant Biology 2024Quote: ... centrifuged for 2 minutes before running through 4-20% mini Protean TGX Stain Free Gel (BioRad, USA). The separated proteins were transferred to Immobilon®-P PVDF membrane (Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... consisting of 4% (vol/vol) of 19:1 acrylamide/bis-acrylamide (BioRad, 1610144), 60 mM Tris⋅HCl pH 8 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1 h at 4°C in a sealed gravity column (Bio-Rad). The beads on the gravity column were washed with 50 ml of high-salt wash buffer (20 mM HEPES ...
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Microbiology 2020Quote: ... The membranes were incubated overnight at 4°C in blocking solution 5% (w/v) Blotting-Grade Blocker (BioRad) in PBS-Tween buffer (1× PBS ...
-
bioRxiv - Cell Biology 2022Quote: Equal volumes (5 µg) of the prepared co-IPs were separated by SDS-PAGE (4–15%, Bio-Rad) and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated 5 min at 95 °C and separated on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins could be detected with an infrared imager (Odyssey ...
-
bioRxiv - Molecular Biology 2023Quote: ... heated at 95°C for 5 min then run on a 4-12% Bis-Tris gel (BioRad 3450125). The input sample is identical to the initial solution containing protein in 60 μL 1x selection buffer prior to capture with 20 passages over the ME200 tip ...
-
bioRxiv - Neuroscience 2023Quote: ... with 5% β-Mercaptoethanol then loaded on 4-20% Criterion TGX Precast Midi protein gels (Bio-Rad #5671094). The gels were run in TGS buffer (1x ...
-
bioRxiv - Biochemistry 2024Quote: ... boiled for 5 min and then resolved on 4-20% (w/v) gradient SDS-PAGE gels (Bio-Rad) with Tris-glycine buffer ...
-
bioRxiv - Biophysics 2024Quote: ... the solution was heated and slowly cooled from 80°C to 4°C (ramp rate of -1°C per 5 s) in a standard thermocycler (Bio-Rad CFX96 Real-Time System) prior to each experiment.
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Biochemistry 2024Quote: ... then loaded on 4–15% or 4-20% polyacrylamide Tris-glycine gradient gels (Bio-Rad, Hercules, CA). Following electrophoresis ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... protein extracts were prepared in lysis buffer with 2% SDS and resolved in a 4-12% gel (Biorad). Membranes were probed overnight at 4°C ...
-
bioRxiv - Genomics 2023Quote: ... proteins were transferred (80 V; 2 h; 4°C) onto a 0.2 µm nitrocellulose membrane (Bio-Rad 1620112). Membranes were air-dried ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein separation was performed on Mini-Protean TGX (4-15% or 4-20%) SDS-PAGE gel (Bio-Rad) and transferred to PVDF membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM tris ...
-
bioRxiv - Cancer Biology 2023Quote: ... All western blots were run using PROTEAN TGX precast 4-15% or 4-20% gradient gels (Bio-Rad) and transferred to either 0.2μm or 0.44μm nitrocellulose membranes ...
-
bioRxiv - Immunology 2022Quote: ... incubated for five days at 4°C in 40 mL of hydrogel monomer solution [4% acrylamide (Bio-Rad), 0.05% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Physiology 2024Quote: ... Proteins were resolved in 4–20% or 4–15% Mini-PROTEAN TGX gels (BIORAD, 4561093 and 4561083, respectively) and transferred onto TransblotTurbo midi-size nitrocellulose membranes (0.2 μm pore size ...
-
bioRxiv - Molecular Biology 2020Quote: ... samples were boiled for 5 min and equal volumes were loaded onto a 4-15% gradient gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Developmental Biology 2020Quote: ... the membrane was blocked overnight at 4°C using 5% non-fat dry milk (Bio-Rad, catalog 170-6404) in Tris-buffered saline pH 7.3 ...