Labshake search
Citations for Bio-Rad :
101 - 150 of 1578 citations for 3 2 Bromophenyl 9 phenyl 9H carbazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Pathology 2024Quote: ... non–linear 3-10 pH gradient (Bio-Rad), followed by SDS-PAGE separation on 8-16% polyacrylamide gradient midi gels (Criterion TGX gels ...
-
bioRxiv - Bioengineering 2020Quote: ... quantification was performed using a Bio-Rad Fast Acid Analysis HPLC Column (100 x 7.8 mm, 9 μm particle size; CAT#: #1250100, Bio-Rad Laboratories, Inc., Hercules, CA) at 65 °C ...
-
bioRxiv - Bioengineering 2020Quote: ... Chromatographic separation was performed using a Rezex Fast Acid Analysis HPLC Column (100 x 7.8 mm, 9 μm particle size; CAT#: #1250100, Bio-Rad Laboratories, Inc., Hercules, CA) at 55 °C ...
-
bioRxiv - Immunology 2022Quote: ... cell debris was removed by centrifugation and clear supernatants were diluted 10-fold and subjected to anion exchange chromatography on gravity fed columns using AG-1 9 8 resin (formate form, 100–200 mesh size, Bio-Rad Laboratories, Hercules, CA). Fractions containing inositol mono ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Chromatographic separation was performed using a Bio-Rad Fast Acid Analysis HPLC Column (100 x 7.8 mm, 9 μm particle size; CAT#: #1250100, Bio-Rad Laboratories, Inc., Hercules, CA) at 65 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Chromatographic separation was performed using a Bio-Rad Fast Acid Analysis HPLC Column (100 x 7.8 mm, 9 μm particle size; CAT#: #1250100, Bio-Rad Laboratories, Inc., Hercules, CA) at 65 ℃ ...
-
bioRxiv - Physiology 2020Quote: ... The same blood samples were used to analyze the fluctuations in cytokine profiles using Bio-plex (GI 23-Plex and GII 9-Plex: Bio-Rad, Hercules, CA, USA), in accordance with the manufacturers’ instructions.
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Microbiology 2024Quote: ... 1 % 2-Mercaptoethanol (Biorad)) and bead beat for 2 minutes at maximum speed (Biospec Mini Beadbeater) ...
-
bioRxiv - Bioengineering 2024Quote: ... equipped with a refractive index detector following isocratic elution on a Aminex HPX-87H column (300 x 7.8 mm, 9 µm particle size; Bio-Rad Laboratories, CA, USA, cat. # 1250140) for a total run time of 20 min employing 5mM H2SO4 as mobile phase buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Systems Biology 2020Quote: ... 50 mM DTT) and 3 mL oil (Biorad #1864006). After encapsulation ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Neuroscience 2022Quote: ... and analyzed with Opticon Monitor 3 and GeneX (BioRad) software ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed in 3% paraformaldehyde (Bio-rad) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... from a 3% low range agarose gel (BioRad, 1613107) to remove adapter dimers.
-
bioRxiv - Biophysics 2024Quote: ... 0.2% (w/v) Bio-Lyte 3/10 Ampholyte (BioRad), 1% bromophenol blue) ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Immunology 2021Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Immunology 2022Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Genomics 2020Quote: ... + 2 μl SilentFect (Bio-Rad) was incubated at RT for 5 min before mixing with 2 μl siRNA (20 μM stock ...
-
bioRxiv - Cell Biology 2020Quote: ... 2× loading buffer (Biorad, 1610768) was added to hairpin samples ...
-
bioRxiv - Microbiology 2020Quote: ... and 2-mercaptoethanol (Bio-Rad), heated at 100°C for 5 minutes ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... and MOMA-2 (Bio-Rad). Plaque size was analyzed by ORO staining to provide contrast ...
-
bioRxiv - Microbiology 2022Quote: ... + 2-mercaptoethanol (Bio-Rad #1610710) directly to the cell monolayer followed by incubation at 95°C for 15 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mm cuvette (Bio-Rad). The mixture was recovered for 2-3 h in 1 mL of NB medium at 28℃ and then cultured for 2 h after adding aTc to a final concentration of 200 μg/mL ...
-
bioRxiv - Biophysics 2023Quote: ... 2% bis-acrylamide (Bio-Rad), and fluorescent beads (yellow or Texas red with ~0.5 μm diameter ...
-
bioRxiv - Genomics 2023Quote: ... 0.128mM 2-Mercaptoethanol (BioRad 1610710XTU), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF) ...
-
bioRxiv - Molecular Biology 2024Quote: ... + 2 µl SilentFect (Bio-Rad) was incubated at room temperature (RT ...
-
bioRxiv - Genomics 2024Quote: ... 2% (Bio-Rad, 161-0142); Ammonium persulfate (Sigma-Aldrich ...