Labshake search
Citations for Bio-Rad :
51 - 100 of 1578 citations for 3 2 Bromophenyl 9 phenyl 9H carbazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis and transfers of proteins to .45uM nitrocellulose membranes were performed using the Protean 2 or 3 systems (Bio-Rad) and protocols provided by the manufacturer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... equipped with an Aminex HPX-87C column (300 × 7.8 mm, 9 μm; Bio-Rad, CA, USA). The column was maintained at 40°C ...
-
bioRxiv - Microbiology 2020Quote: ... which subsequently performed 2-DE using a 7 cm immobilized pH gradient (IPG) strips (pH range of 3—10, Ready strip, Bio-Rad, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Microbiology 2021Quote: ... PCR conditions followed the general Bio-Rad recommendations.9 Data was analyzed with QuantaSoft_v1.7 software (Bio-Rad) including automatic Poisson correction.9,11
-
bioRxiv - Systems Biology 2023Quote: ... then cells stained for analysis by flow cytometry 9 or 10 days after dCas9 infection (BioRad ZE5). In some cases ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The conjugated beads were then packed into a 9 mL glass column (Bio-Rad laboratories, Hercules, CA, USA). The dimeric APPI (15 mL ...
-
bioRxiv - Biochemistry 2020Quote: To visualize protein expression 1 μL of the TXTL reactions was mixed with 2 μL of water and 3 μL of 2x Laemmli loading dye (Bio-Rad, Hercules, CA, USA) and incubated at 90°C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... Equal amounts of protein samples were separated by 9% SDS-PAGE gel and transferred onto nitrocellulose membranes (Bio-Rad). The following primary antibodies were used ...
-
bioRxiv - Plant Biology 2021Quote: ... The following components were added to a reaction tube: 9 μL of iQ SYBR Green Supermix solution (Bio-Rad), 1 μL of 5 mM specific primers ...
-
bioRxiv - Bioengineering 2020Quote: ... EG depletion was monitored using on an Aminex HPX-87H ion exclusion column (300 mm x 7.8 mm, particle size 9 μm; Bio-rad). The column was maintained at 40°C and samples were isocratically eluted using 0.014 N H2SO4 at a flow rate of 0.55 ml min-1 and read on a refractive index detector (RID) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All reagents except the double-stranded beacon were first assembled in a total volume of 9 μL and run at 37 °C in a CFX96 real-time PCR detection system (Biorad). Both WT SpCas9 and SpCas9-NG are highly active at this temperature ...
-
bioRxiv - Immunology 2022Quote: ... Lysates containing 40 μg of proteins were analyzed by SDS-PAGE on 9-13% gels and proteins were transferred onto nitrocellulose membranes (BioRad). The blots were blocked in non-fat milk diluted in tris-buffered saline (TBS ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was isolated from 6-week-old rosette leaves and bolting flower buds of Col-0 and one of the RPF2-atp1 (RPF2-atp1-9) transformed lines (T3) with PureZol reagent (BioRad). Three independent libraries for each genotype were made from total RNA treated with 250 ng of Turbo DNase (Ambion ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2 M 2-Mercaptoethanol (Bio-Rad), and boiled for 3 min ...
-
bioRxiv - Biochemistry 2021Quote: ... The cells were replenished with compounds every 24 h and counted on days 1-9 using automated cell counter (Bio-Rad). KYSE-520 cells were plated onto 96-well plates (500 cells per well ...
-
bioRxiv - Biochemistry 2021Quote: ... RQN > 9) were prepared using the NEBNext Ultra II Directional RNA Library Kit for Illumina with NEBNext rRNA depletion (Bio-Rad). Protocols were followed as per the manufacturer’s guidelines except that 40X adaptor dilutions were utilized ...
-
bioRxiv - Microbiology 2021Quote: ... Sugar consumption and the metabolite production were analyzed using HPLC Prominence (Shimadzu) with ion exclusion column Aminex ®HPX-87H (300×7.8mm×9 μm) (Bio-RAD), isocratically eluted at 60 °C with 5 mM sulfuric acid flow rate of 0.6 mL.min-1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was generated by reverse transcription of up to 9 ng RNA from each sample using iScript Reverse Transcription Supermix for RT-qPCR (BioRad, 1708841). mRNA expression was determined on a StepOnePlusTM Real-Time PCR System (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... The immunoprecipitated proteins from three treatments were mixed and either denatured by 9 M Urea/20 mM HEPES buffer or mixed with 2x Laemmli Sample Buffer (1610737, Bio-Rad) and separated by SDS-PAGE to analyze individual fractions ...
-
bioRxiv - Physiology 2023Quote: ... Samples were run 16 h at 9 °C at 4 V with a 1–10 running ratio in TBE buffer using CHEF-DRII system (Bio-Rad). After the run ...
-
bioRxiv - Genomics 2023Quote: Pooled blood cells from 9 adults were counted and their viability was assessed using an automatic cell counter (Bio-Rad TC20) with Trypan Blue staining ...
-
bioRxiv - Genetics 2023Quote: ... China) using TBE (65 mM Tris-HCl, 27 mM boric acid, 1 mM EDTA, pH 9; Bio-Rad, Hercules, CA, USA) as the buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... to make 8 mL of 9% resolving Phos-tag gel solution (enough for one 1.5 mm Bio-Rad mini gel cast), the following reagents were mixed together evenly ...
-
bioRxiv - Cancer Biology 2020Quote: ... a ddPCR reaction was prepared (13 μl mastermix and 9 μl cfDNA) and subsequently ran on a QX200 ddPCR system according to protocol (Bio-Rad Laboratories). Data analysis was performed using QuantaSoft v1.7.4.0917 (Bio-Rad Laboratories) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribonucleoprotein (RNP) complexes were made at a 9:1 ratio of sgRNA:Cas9 (90pmol:10pmol) in Gene Pulser® Electroporation Buffer (Bio-Rad, 1652677) and incubated for 10 min at RT ...
-
bioRxiv - Physiology 2023Quote: ... 0.03% bromophenol blue) containing 9% beta-mercaptoethanol and separated by Mini-Protean TGX gel 4 - 15% (BioRad, stain-free gels #4568084, 4561035) and blotted onto Amersham Hybond-P PVDF membrane ...
-
bioRxiv - Cell Biology 2024Quote: A total of 10 µg of protein was combined with 5 µL of Laemmli buffer (1:9 β-mercaptoethanol [PCS 1610710, Bio-Rad] to Laemmli sample buffer [PCS 161-0737 ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Neuroscience 2022Quote: After 9-13 days in culture, organotypic hippocampal slices were transfected biolistically with gene gun (McAllister, 2000) using gold beads (Bio-Rad, 1.6 µm) coated with plasmids ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Sixty μg of each protein sample was run on 9% polyacrylamide gels and transferred to a nitrocellulose membrane with the Turbo Blotdry blot system (Biorad, Hercules, CA, USA). After transfer ...
-
bioRxiv - Cell Biology 2024Quote: A total of 10 µg of protein was combined with 5 µL of Laemmli buffer (1:9 β-mercaptoethanol [PCS 1610710, Bio-Rad] to Laemmli sample buffer [PCS 161-0737, Bio-Rad]) and sufficient water to reach a final volume of 20 µL ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...