Labshake search
Citations for Bio-Rad :
101 - 150 of 3846 citations for 1 3 Methoxyphenyl 6 7 dimethyl 6 azoniabicyclo 3.2.1 octane bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The 10 µl reactions were purified with Bio-Spin® 6 Columns (Bio-Rad), and mixed with 10 µl of RNA loading dye (95% formamide ...
-
bioRxiv - Microbiology 2024Quote: ... or homemade 6-15% SDS-PAGE gels and transferred to a nitrocellulose membrane (Biorad). The membrane was blocked in 10% non-fat dry milk in TBS-T and stained with primary antibody overnight at 4°C or 2-3 hours at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... The reaction was cleaned up by P-6 Micro Bio-Spin Column (Bio-Rad). For fluorophore labeling ...
-
bioRxiv - Microbiology 2022Quote: ... Unquenched periodate was removed using Micro Bio-Spin P-6 columns (Bio-Rad Laboratories) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad), added to 445 μL Sonication buffer (20 mM Tris-HCl pH7.5 ...
-
bioRxiv - Immunology 2023Quote: ... Aortic root sections (6 µm) were stained for CD68 (Bio-Rad MCA1957; Hercules, CA) to detect macrophages ...
-
bioRxiv - Molecular Biology 2023Quote: ... the RNA was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Aortic root sections (6 µm) were stained for CD68 (Bio-Rad MCA1957; Hercules, CA) to detect macrophages ...
-
bioRxiv - Immunology 2024Quote: ... 6 µg of the concentrated protein underwent separation on stain free SDS-PAGE (BioRad) under reducing conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... bromophenol blue) was applied onto IPG strip (7 cm, pH 3-10, Bio-Rad, 1632000) for 24 h ...
-
bioRxiv - Microbiology 2023Quote: ... Tissues were rinsed in DBPS and moved to semi-solid media (6:4 ratio of 1% agarose (BIO-RAD, Hercules, CA, USA) in DPBS:DMEM with 10% FBS) ...
-
bioRxiv - Pathology 2023Quote: ... Heparin Sepharose 6 Fast Flow beads (1 ml) (Healthcare Life Sciences) were loaded into disposable Bio-Spin® chromatography columns (Bio-Rad) and packed with 2 ml of equilibration buffer (0.15 M NaCl in 25 mM HEPES ...
-
bioRxiv - Immunology 2024Quote: ... were covalently coupled to carboxyl-functionalized fluorescent magnetic beads (1-3µg/1.25*10^6 beads) (Luminex Corp. MagPlex® Microspheres; Bio-Rad; Temse, Belgium) employing the BioPlex amine coupling kit (Ref. ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were blocked in 6% milk in PBS and subsequently stained with mouse anti-V5 (clone SV5-Pk1, BioRad, 1:10 000) and goat anti-mouse (1:100 000 ...
-
bioRxiv - Molecular Biology 2020Quote: Obtain ethidium bromide solution (10 mg/ml, Bio-Rad 1610433), ensure this is less than 2 years old ...
-
bioRxiv - Molecular Biology 2020Quote: ... The adaptor was cleaned up on a Micro Bio-Spin 6 chromatography column (Bio-Rad) equilibrated with water ...
-
bioRxiv - Biochemistry 2022Quote: ... with the mini profinity IMAC and mini Bio-Gel P-6 desalting cartridges (Bio-Rad). The protein concentration and purity were verified by Bradford Protein Assay (Bio-Rad ...
-
bioRxiv - Biochemistry 2022Quote: ... 10mM BME) at room temperature using Micro Bio-Spin 6 columns (Bio-Rad CAT# 7326200). PARLSkd3 concentration was measured via A280 and the molar extinction coefficient and PARLSkd3 concentration was adjusted to 30 μM ...
-
bioRxiv - Neuroscience 2020Quote: ... and 10 μg of protein was loaded onto an acrylamide gel (6–15%; Bio-Rad). Gel electrophoresis was performed in Tris- glycine-sodium dodecyl sulfate (SDS ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Beads SM-2 Resin and Bio-Gel P-6 were obtained from Bio-Rad Laboratories Inc ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Labeled probes were then purified using Micro Bio-Spin 6 Chromatography Column (BioRad, Berkeley, CA), and 1 μl of the probe was counted for subsequent radioactivity dilution calculations ...
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Biophysics 2022Quote: ... The modified probes were purified using a P-6 Micro Bio-Spin Column (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA probe was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad), denatured 5 min in 95°C and cooled on ice ...
-
bioRxiv - Immunology 2022Quote: ... using the magnetic rack (6-Tube SureBeads™ Magnetic Rack #1614916 BIORAD Hercules, CA, USA) to magnetized them ...
-
bioRxiv - Biophysics 2024Quote: ... Primer extension reactions were desalted by spinning in the P-6 micro-biospin column (BioRad). Each sample was diluted in deionized formamide (Hi-Di™ Formamide ...
-
bioRxiv - Biochemistry 2024Quote: ... A transfer sandwich was constructed using 6 transfer buffer-soaked blotter papers (#1704085, BIO-RAD) (Fig ...
-
bioRxiv - Bioengineering 2024Quote: ... IL-1β and IL-6 CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA). The sequences of the primers used ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM DTT and 0.5% OGNPG) on a Micro Bio-Spin 6 column (Bio-Rad) and then diluted to a concentration of 10 mg/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were resolved on 7 cm pH 3-10 immobilized pH-gradient (IPG) strips (Bio-Rad), under mineral oil ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted using a 20:7:3 mixture of buffer: 4x Laemmli sample buffer (Biorad):10x NuPage sample reducing agent (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...