Labshake search
Citations for Bio-Rad :
401 - 450 of 3846 citations for 1 3 Methoxyphenyl 6 7 dimethyl 6 azoniabicyclo 3.2.1 octane bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and stained with ethidium bromide for band visualization at an expected length of 244bp using the Gel Doc System 2000 (Bio-Rad Laboratories-Segarate, Milan, Italy). Of the 136 PCR-positive sample ...
-
bioRxiv - Microbiology 2020Quote: ... and stained with ethidium bromide for band visualization at an expected length of 244bp using the Gel Doc System 2000 (Bio-Rad Laboratories-Segarate, Milan, Italy). Of the 136 PCR-positive sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... an affinity purified antibody generated against the SAX-7 cytoplasmic tail [gift of (Chen et al., 2001)] and 1:5000 goat anti-rabbit HRP secondary antibody (Bio-Rad #170-5046). For the loading control ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Microbiology 2024Quote: ... lysates were collected and mixed 3:1 with 4x Laemmli sample buffer (Bio-Rad 1610747). Samples were heated at 95°C for 10 min and then separated on SDS-PAGE and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... Membrane was washed 3 times and incubated with secondary peroxidase antibodies (1:1000, Bio-RAD) 1 hour in TBS-Tween 1% ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... Specific primers (Supplementary Table 7) and SSO SYBR Green Supermix (Bio-Rad) were used in qPCR reactions following manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... For experiments performed using QS 7 Flex (TFS) and BioRad CFX384 (BioRad), Hard-Shell® ...
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were run in a 2% agarose slab gel and stained with ethidium bromide for visualization by UV shadowing (Bio-Rad Molecular Imager Gel Doc XR+).
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 μL polyacrylamide (PA) solution containing 7% acrylamide monomer (Bio-Rad, Hercules, CA), 0.35% bisacrylamide crosslinker (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... using the Trans-Blot Turbo Transfer System (Bio-Rad, 7 mins at 20V).
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... Densitometry analysis was carried out using Image Lab (v6.1.0 build 7, Bio-Rad, SG). Briefly ...
-
bioRxiv - Immunology 2024Quote: ... Blot images and bands were quantified using ImageLab software (version 6.10, build 7; BioRad).
-
bioRxiv - Neuroscience 2024Quote: ... and transferred for 7 minutes on a nitrocellulose membrane (Bio-Rad, Hercules, CA, 1620233) in XT transfer buffer (Bio- Rad ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected with 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad). The CA levels from cells were normalized relative to GAPDH levels ...
-
bioRxiv - Neuroscience 2020Quote: ... Three replicas of 1.5μl of a 1:3 dilution of cDNA were amplified using SsoFast EvaGreen Supermix (BioRad) for FACS-sorted microglia and Power SYBR Green (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on the 4-20% Criterion TGX Stain-Free Precast gels (BioRad) in Tris/Glycine/SDS running buffer (BioRad ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was washed again with 1x PBS-T (0.075 %) 3 times 10 minutes each and incubated with 1:1 ECL chemiluminescence solution (Clarity Western ECL, #170-5061, Bio-Rad Laboratories, Hercules, CA, USA). Signal was detected using an Amersham AI600 imager (Supplementary Table 5).
-
bioRxiv - Biophysics 2023Quote: GAGs were purified with a column of 7 mm diameter and 10 cm length (BioRad) packed with Sephadex G25 resin (Sigma-Aldrich # G25150) ...
-
bioRxiv - Genomics 2024Quote: ... The membrane was first blocked with 7% nonfat dry milk (Bio-rad, catalog no. 1706404) in PBS for 1 hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-Rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase activity was measured as described in the FAM FLICA caspase 1 and 3 kit (Bio-Rad, Hercules, USA). Lysosomal and mitochondrial content as well as production of ROS were analysed by staining with 50 nM LysoTracker™ Deep Red ...
-
bioRxiv - Bioengineering 2023Quote: ... 7 μL RNase-free water and 10 μL iQ SYBR○R Green Supermix (Bio-Rad, USA). The standard curves were constructed from a series of 10-fold dilutions of a plasmid DNA obtained by TOPO TA cloning (ThermoFisher ...
-
bioRxiv - Physiology 2023Quote: ... Standard SDS-PAGE was performed with BioRad 7-12% TGX gels (4561086; BioRad, Hercules, CA, USA) and polyvinylidine difluoride (PVDF ...
-
bioRxiv - Plant Biology 2024Quote: ... consisting of 7 μL Sso Advanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 0.28 μL of each primer (10 μM) ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Plant Biology 2022Quote: ... the membrane was incubated 3 h with a solution containing a secondary goat-HRP anti rabbit (1:10 000) (Biorad) (milk 0.5 % TBST) ...
-
bioRxiv - Neuroscience 2023Quote: ... Free floating sections were blocked with 3% donkey serum and incubated overnight with rat anti-CD68 (1:200, Bio-Rad). Aβ deposition and CD68 staining were both developed with a Vectastain ABC kit and DAB reaction ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Biochemistry 2023Quote: For VP protein analysis 3×109-1×1010 vg of purified AAV were mixed with 12.5 µl 4x Laemmli Sample Buffer (Bio-Rad, supplemented with 10% 2-mercaptoethanol ...
-
bioRxiv - Immunology 2024Quote: ... Membranes were washed with TBS-T (3 x 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... We loaded 10 µL of proteins at 10 µM mixed in a 3:1 ratio with 4X Laemmli Buffer Sample (Biorad) provided with 10% DTT ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed with TBST 3 times for 5 minutes each before applying secondary fluorescent antibody (1:2,500, StarBright Blue 520 Bio-Rad) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...