Labshake search
Citations for Bio-Rad :
1401 - 1450 of 8193 citations for Estrone 3 Glucuronide E1G ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Biophysics 2019Quote: Proteins for native mass spectrometry were buffer exchanged into 50mM ammonium acetate by 3 rounds of gel filtration using BioGel P6 (Biorad) spin columns according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A total of 3 μg of protein was loaded to Mini-PROTEAN TGX Stain-Free Gels (10% gel, BIO-RAD). Proteins were transferred to standard PVDF membranes through an OWL semi-dry transfer apparatus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Bound proteins were washed 3 times in 500 mM KCl and eluted on Bio-spin disposable chromatography columns (Bio-Rad) with flag peptide as described in (88) ...
-
Checkpoint adaptation in repair-deficient cells drives aneuploidy and resistance to genotoxic agentsbioRxiv - Cell Biology 2019Quote: ... Images were taken after 3 to 4 days (unless indicated otherwise) using the ChemiDoc™ Touch Imaging System (Bio-Rad). Agar plates contained the vital dye Phloxine B at a final concentration of 8 µg/mL.
-
bioRxiv - Developmental Biology 2020Quote: ... Western blots were performed either with Criterion ™ XT Tris-Acetate Precast Gels 3–8 % (3450130, Bio-Rad, Hercules, CA), XT Tricine running buffer (161–0790 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers (Table 3) were designed using Primer3 Plus (31, 32) to quantify transcripts using Universal SYBR Green Supermix (Bio-Rad) using a Quantstudio 6 Flex (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... ± phosphatase inhibitor cocktail 3) and incubated for 30 min on ice before addition of MnCl2 and λ-phosphatase (Bio-Rad) to the appropriate samples for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was subsequently washed 3 times in TBS+0.05 % Tween-20 over 45 min and incubated with secondary antibodies for 1 h at RT (20 °C) after washing 3 times in TBS+0.05 %Tween-20 and developed by enhanced chemiluminescence (Bio-Rad) with Image Quant™ LAS 4000.
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were washed with PBS-T 3 times after each step and finally imaged on the ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Microbiology 2022Quote: ... 3-Hydroxypropionate samples were eluted through a 300 mm × 7.8 mm Aminex HPX-87H column (Bio-Rad, Hercules, CA, USA) at 55 °C using 5 mM H2SO4 (flow rate 0.6 mL/min ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA and RNA were sheared through sonication and dotted (3 µg) on the nitrocellulose membrane (BIO-RAD, Cat No: 1620112). The membrane was baked at 80⁰C for 2 h and blocked-in phosphate-buffered saline (PBS-Tween 0.05% ...
-
bioRxiv - Cell Biology 2022Quote: ... and assays (Table S3) were used for real-time qPCR (Thermo Fisher, Applied Biosystems QuantStudio 3 and BioRad CFX 384) to determine CXCL12 ...
-
bioRxiv - Plant Biology 2022Quote: ... A total of 3 ml of Ni2+- loaded resin was packed into Econo-Pac columns (cat. Number 7321010 – Bio-Rad) and equilibrated with 3 column volumes (CV ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a ratio of 1:2 in 100 µL of TE by heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). In Figures ...
-
bioRxiv - Molecular Biology 2022Quote: ... and heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). Primer extension assays were performed either as time courses (up to 240 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR program was run on ABI QuantStudio 3 with iTaq Universal SYBR Green Supermix (#1725121, Bio-Rad, Hercules, CA,) using human Il6 and mouse B2m ...
-
bioRxiv - Cancer Biology 2023Quote: ... an equal volume of the cell suspension was added to the chamber of the counting slide (3 technical replicates) and counted with the TC20 automated cell counter (BioRad).
-
bioRxiv - Immunology 2023Quote: ... Protein denaturation before separation was done by treating the cell lysates for 3 min at 95°C in presence of 1x XT Sample Buffer (BioRad) and 1x XT reducing agent (BioRad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed and blocked in 1x TBST with 5% bovine serum albumin before consecutive incubation with primary antibody (see Suppl. Table 3) and horseradish peroxidase-coupled protein A (Cymed) and detection using Clarity Western ECL Substrate (BioRad).
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... The blots were washed in TBST (3 x 10 min) and scanned on a ChemiDoc MP imaging platform (Bio-Rad).29,30
-
bioRxiv - Microbiology 2024Quote: ... with transfer buffer (14.4 g/l glycine, 3 g/l Tris base and 15 % methanol) using mini-wet electroblotting system (Bio-Rad) at 55 V for 130 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... For each condition 3 biological replicates with two technical replicate RT-qPCR reactions were run on a CFX96 Connect Real-Time System (BioRad). The number of il1b ...
-
bioRxiv - Physiology 2020Quote: ... cDNA was synthesized using a reverse transcription kit (iScript cDNA synthesis kit; Bio-Rad, Hercules, CA) from 1 μg of total RNA ...
-
bioRxiv - Cell Biology 2019Quote: ... Aurum Total RNA Mini Kit (BioRad) was used ...
-
bioRxiv - Developmental Biology 2021Quote: ... An iScript cDNA synthesis kit (BioRad) was used on 500ng of RNA for cDNA synthesis ...
-
bioRxiv - Developmental Biology 2021Quote: ... An iScript cDNA synthesis kit (BioRad) was used on 500ng of RNA for cDNA synthesis ...
-
bioRxiv - Molecular Biology 2021Quote: ... iScript cDNA synthesis Kit (Biorad, 1708891) was used to transcribe the isolated RNA to first strand cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the iScript kit (Bio-Rad). qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... and a colorimetric detection kit (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... AP conjugate substrate kit (Bio-Rad) was used to develop spots ...
-
bioRxiv - Cancer Biology 2022Quote: ... The SsoFast EvaGreen Supermix kit (BioRad) was used for qRT-PCR using recommended cycling conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... The iScriptTM cDNA Synthesis Kit (BioRad) was used to transcribe 500ng of total head RNA according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... iScript cDNA synthesis kit (Bio-Rad) to reverse transcribe total RNA into cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... The iScript cDNA Synthesis Kit (BioRad) was used to generate cDNA from equal amounts of total RNA (1mg ...
-
bioRxiv - Cell Biology 2021Quote: ... or iScript cDNA synthesis kit (BioRad). cDNA was diluted five-fold and quantitative PCR (RT-qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... synthesis kit (Bio-Rad, Hercules, CA). CoV-2 S and N transcripts and 18s rRNA were quantified by ddPCR with specific primers (CoV-2 RNA Leader ...
-
bioRxiv - Immunology 2022Quote: ... or iScript cDNA synthesis kit (BioRad) according to the manufacturer guidelines ...
-
bioRxiv - Biochemistry 2022Quote: ... using the ChemiDoc kit (BIO-RAD) and digitalized with the Chemi-Doc XRS System (BIO-RAD).
-
bioRxiv - Plant Biology 2022Quote: ... Bradford protein assay kit (Bio-rad) was used to determine protein concentration ...
-
bioRxiv - Neuroscience 2022Quote: ... or iScript cDNA synthesis kit (Biorad) for mRNA detection ...
-
bioRxiv - Cell Biology 2024Quote: ... SYBR Green Master mix kit (BioRad) and Stratagene Mx3000p detection system were used to perform quantitative analysis of gene expression ...
-
bioRxiv - Cell Biology 2023Quote: ... A DC protein assay kit (BioRad) was used to determine the protein concentration of individual samples ...