Labshake search
Citations for Bio-Rad :
1401 - 1450 of 8520 citations for 7 hydroxy 1H 1 2 4 triazolo 1 5 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... for 7 min in a Trans-Blot Turbo Transfer System (BioRad). Membranes were blocked with 3% BSA in TBST and incubated with mouse anti-His monoclonal antibody overnight in a cold room ...
-
bioRxiv - Cell Biology 2019Quote: ... and droplet generation oil (Bio-rad, 1864006; 7 ml per run), were connected to a microfluidics device (FlowJEM ...
-
bioRxiv - Immunology 2021Quote: ... and mouse anti-pig CD203a-FITC (clone PM18-7; Bio-Rad). Granulocytes were defined as 2B2+CD203a- ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were then transferred to a Minisize PVDF 7 membrane (BioRad) using a semi-dry transfer (TurboBlot ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PV1s (7 μg) and molecular weight marker (Dual Color, Bio-Rad) were transferred from SDS-PAGE 16% gels onto nitrocellulose membranes (Amersham ...
-
bioRxiv - Plant Biology 2020Quote: ... or 1 μl (for the rest) of a 1/2 dilution of the cDNA was added to a reaction containing 1X of SsoFast EvaGreen (Bio-Rad, USA), 0.5 μM Forward and Reverse primers (Table 2) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 60 of High Capacity NeutrAvidin slurry (Thermo PI29204) were washed three times with 1 mL 2X RIPA/1mM EDTA buffer in 2-mL chromatography columns (Bio-Rad 7326008) attached to a vacuum manifold (Promega A7231) ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were visualized with goat anti-mouse or goat anti-rabbit IgG secondary antibodies (1:5000) diluted in 2% Omniblot milk (AmericanBio) in 1X TBST using a chemiluminescence detection system (BioRad ChemiDoc MP).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Protein lysates were boiled in loading buffer [1:9 ratio of 2-mercaptoethanol:4x Laemmli Sample Buffer (Cat.#1610747; Bio-Rad Laboratories)] for 10 min ...
-
bioRxiv - Genomics 2019Quote: ... RECA-1 (BioRad, MCA970GA), synaptopodin (Progen ...
-
bioRxiv - Molecular Biology 2019Quote: ... V5 (BioRad, 1:5,000); α-Tubulin (Upstate Biotech ...
-
bioRxiv - Microbiology 2019Quote: ... (1:2000, Biorad, 1706516) for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... 1% SDS (Bio-Rad), 0.005% Bromophenol Blue (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM DTT (BioRad), 20 mM 12.5% glycerol (Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM DTT (BioRad), 15 mM EGTA (Fisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... aromatase (1:1000, BioRad), or loading control GAPDH (1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... 1:2000 (#MCA4740, BioRad), mouse anti-mCherry ...
-
bioRxiv - Cell Biology 2019Quote: Polymerization of the soft pre-mix was started immediately after the previous step by addition of 5 µl 10% ammonium persulphate (APS; BioRad) and 1 µl N ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... by Bio-Rad tans-blot turbo transfer system at mixed weight transfer setting and incubated in 5% blotting grade blocker (BioRad Catalog: 1706404) solution for 1 hour ...
-
bioRxiv - Developmental Biology 2020Quote: ... genomic DNA was obtained by incubating the samples (whole embryos or adult caudal fin fragments) in TE buffer supplemented with 5% Chelex-100 (BioRad) and 10 μg/ml Proteinase K (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... Tween 20 (TBS-T) in 5% (w/v) milk (pH 7.4) followed by incubation with an anti 6xhistidine antibody (Bio-Rad) overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... The dried pellets enriched for histones were dissolved in sample buffer (8 M urea, 5% β-mercaptoethanol and 10 mM Tris-HCl (pH 7.0)) and added sample loading buffer (Biorad XT sample buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The blots were washed four times with TBS-T for 5 min each prior to developing with Clarity Western ECL Blotting Substrates (BioRad) and imaging on a UVP BioSpectrum Imaging System ...
-
bioRxiv - Developmental Biology 2022Quote: ... the gel was incubated in 1x TBE for 10 min and after was stained with Green Safe reagent dye (5 µL /100 mL of TBE 1x) for 30 min and visualized on ChemiDoc XRS+ system (BioRad).
-
bioRxiv - Biochemistry 2020Quote: ... proteins were dialyzed in HEPES sodium salt-HCl (75 mM, pH 7.0) with Chelex-100 resin (5 g/L, Bio-Rad) to remove any divalent metal contaminants ...
-
bioRxiv - Molecular Biology 2019Quote: ... in TE (25 min) followed by de-staining in TE (5-10 min) and imaging on a ChemiDoc XRS+ instrument (BioRad). The fraction of nucleosomal DNA shifted was quantified using Image Lab 6.0.1 (BioRad ...
-
bioRxiv - Plant Biology 2021Quote: ... The blot was washed with TBST (TBS with 0.1% tween 20) and was blocked with either 5% blotting grade blocker (Bio-Rad) or 4% BSA (Sigma ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... The 20 μL reaction mix contained 5 μL sample or standard DNA together with 10 μL 2x SsoAdvanced Universal Probes Supermix (Biorad), 1 μL of each primer (5 μM stock solution) ...
-
bioRxiv - Biochemistry 2021Quote: ... and the proteins containing 5× SYPRO™ Orange were loaded onto Hard-Shell® 96-well PCR Plates (Bio-Rad) for measurement ...
-
bioRxiv - Biochemistry 2021Quote: ... The membrane was first blocked with B-TBST (TBS buffer with 0.05% Tween-20 and supplemented with 5% blotting grade non-fat dry milk; Bio-Rad) for 1 hr at room temperature and subsequently blotted with the primary antibodies in B-TBST overnight at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was resuspended in 5 mL of extraction buffer and transferred to a gravity flow column (Biorad, Hercules, CA). After loading ...
-
bioRxiv - Biophysics 2021Quote: ... 5 µL of purified (mutant) protein sample was mixed with 1.67 µL of 4X Laemmli loading buffer (Bio-Rad 1610747), then 5 µL was loaded onto an SDS-PAGE gel (Either 12% isocratic (Bio-Rad 4561046 ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 µg of protein lysate was heat-denatured at 95°C for 5 minutes in Laemmli sample buffer (Bio-Rad), and then separated using a 4 to 12% Bis-Tris polyacrylamide gel (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: Isothermal assembly reaction buffer (5×) (500 mM Tris-HCl [pH 7.5], 50 mM MgCl2, 50 mM dithiothreitol [DTT] [Bio-Rad] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mean fluorescence intensity was measured to calculate final concentration in pg/mL using Bioplex200 and Bioplex Manager 5 software (Biorad).
-
bioRxiv - Cancer Biology 2020Quote: ... Target sequences in cDNA library were amplified in 10 μl qPCR reaction (5 μl SYBR Green supermix (Bio-Rad #1725121), 0.675 μl 2.5 μM primer mix and 0.45 μl diluted cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were transferred to PVDF membranes and blocked in TBS with 0.1% Tween-20 (TBST) and 5% Blotting Grade Buffer (BGB, Bio-Rad). The anti-RBM20 rabbit polyclonal primary antibody (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were loaded onto Mini-PROTEAN TGX Pre-cast Stain-Free gels (5-15%, Bio-Rad Laboratories, Hercules, CA, USA) and total protein was visualised post-transfer to PVDF membranes on ChemiDoc Touch Imaging System ...
-
bioRxiv - Biochemistry 2022Quote: ... by loading samples onto a 0.5X TBE 5% polyacrylamide gel prepared for a Mini-PROTEAN Tetra Vertical Electrophoresis Cell (Bio-Rad) using ProtoGel acrylamide (National Diagnostics) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The beads were washed 5 times and denatured with 4x Laemmli sample buffer (Cat: 161-0747, BioRad, Hercules, CA, USA) at 100 C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... 5 ng of each sample was loaded into a well of a 10% Mini-PROTEAN TGX Precast Gel (Bio-Rad). Gels were transferred to PVDF membranes (Merck KGaA ...
-
bioRxiv - Genomics 2022Quote: Slot blot was performed using 1.5 ng of gDNA that was denatured in 400 mM NaOH/10 mM EDTA and blotted onto nitrocellulose membrane (BioRad) in duplicate for dsDNA and 5mC DNA using a slot blot apparatus (BioRad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were eluted by heating the beads at 95°C for 5 min in Laemmli Sample Buffer (1610747, Bio-Rad) with 50 mM DTT followed by magnetic separation ...
-
bioRxiv - Cell Biology 2019Quote: ... were boiled for 5 min and then loaded into 10% Mini-Protean TGX (Tris-Glycine eXtended) Stain-Free precast Gels (Biorad). Electrophoresis was performed in a buffer containing 25 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: ... The protein from the 5% of beads was eluted by boiling the beads in Laemmli sample buffer supplemented with BME (BioRad) and 2 mM biotin at 90°C for 10 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 ng of cDNA was analyzed with isoform-specific droplet digital PCR assays and ddPCR Supermix for probes (Bio-Rad). Primers and probes (Integrated DNA Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... The PCR reaction was carried out in 10 μl volume with 5 μl of 2X iTaq Universal Sybergreen Supermix (BioRad), 500 nM of forward and reverse primers (for promoter ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lysates were then denatured in 2X Laemmli at 95°C for 5 minutes and run in Mini-PROTEAN Precast Gels (BioRad) and transferred onto membranes using Trans-Blot Turbo ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...