Labshake search
Citations for Bio-Rad :
51 - 100 of 7728 citations for Estrone 3 Glucuronide E1G ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Antigen-coupled microspheres (1000/well) were incubated with serially diluted samples (1:100, 1:1000, 1:10,000) in replicates in Bioplex plates (Bio-Rad) at 4°C for 16hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration of VSW-3 RNAP was determined by Bradford protein quantitative kit (Bio-rad), and protein purity and concentration were analyzed along with T7 RNAP (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Microbiology 2023Quote: ... and the absorbance was read using an ELISA reader (BIO-RAD) at 450 nm and 570 nm dual filters.
-
bioRxiv - Biochemistry 2020Quote: ... The purified MCU-EMRE subcomplex in DDM was then reconstituted into nanodisc by incubating with Msp1 protein, lipids (POPC:POPE:POPG, 3:1:1 molar ratio) and BioBeads (BioRad) at 4°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We used 1 μL diluted cDNA (1:3 in ddH2O) and iTaq Universal SYBR Green Supermix (Bio-rad) in the Bio-rad CFX96 real-time PCR detection system for qPCR experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 × 10 min with TBST and exposed with a ECL kit (Bio-rad, cat # 1705061) on X-ray films (Kodak ...
-
bioRxiv - Microbiology 2020Quote: ... This was read at 540 nm on an ELISA reader (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... a sandwich ELISA was performed using a matched antibody pair (BioRad, France) as previously described (Totté et al. ...
-
bioRxiv - Microbiology 2023Quote: ... GM testing with the Platelia enzyme-linked immunosorbent assay (ELISA) (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mg/L cefotaxime supplemented Drigalski agar plates (Bio-Rad, Marne-la- Coquette, France) and Cetrimide media on which was deposited a disc of ceftazidime in the 2nd quadrant (bioMérieux) ...
-
bioRxiv - Physiology 2023Quote: ... each fiber was carefully submerged in 3 µL of lysis buffer (SingleShot Cell Lysis kit, Bio-rad), containing proteinase K and DNase enzymes to remove unwanted proteins and DNA ...
-
bioRxiv - Biophysics 2023Quote: Apoptosis was probed using the Bio-Rad Magic Red Caspase 3-7 kit (Bio-Rad, ICT 935). HEK 293T cells stably expressing FGFR1-YFP were seeded in 96 well plates and allowed to grow to ∼70% confluency ...
-
bioRxiv - Biochemistry 2019Quote: ... in 96 well plate (Hard-Shell® PCR plates, BioRad). 4 μM of all studied protein constructs were mixed with different concentrations of peptides ranging from 1 to 200 μM ...
-
bioRxiv - Immunology 2020Quote: ... Plates were sealed with adhesive aluminumized plate covers (Bio-Rad, Microseal® ‘F’ PCR Plate Seal ...
-
bioRxiv - Immunology 2019Quote: ... PCR plates (BioRad) with 4μl of lysis buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... PP2A activity was measured using an ELISA reader (Bio-rad xMARK microplate spectrometer) at a wavelength of 650 nm.
-
bioRxiv - Cancer Biology 2023Quote: ... ELISA-based signaling measurements were performed according to the manufacturer’s instructions (Bio-Rad). The Luminex kits EGFR Y1068-p and p-AKT is S473-p were obtained from Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Biochemistry 2023Quote: ... The runs were performed at 10 V cm-1 (Mini-PROTEAN spacer plate, Bio-Rad) for 45 minutes (or until loading dye reached the bottom of the gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lysates were performed on plates with heated 1× SDS sampling buffer (Bio-Rad, 1610147) and subjected to SDS-PAGE ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Genomics 2020Quote: ... The plate was read using a spectrophotometric plate reader (Bio-RAD) at 405 nm ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentration was determined using a commercial kit (Pierce™ BCA Protein Assay Kit, Thermo Fischer) and measured at 595 nm with a spectophotometer (BioRad iMarkTM Micro Plate Reader). Each sample was prepared using 30 μg of total proteins combined with the appropriate amount of 5X loading buffer (10% β-Mercaptoethanol ...
-
bioRxiv - Microbiology 2022Quote: ... The working solutions of the compounds and DNA hairpins/duplexes were mixed (1:1 ratio, 25 μL of each solution) in the wells of a 96 well plate (Bio-Rad). The wells were covered and placed in a DNA Engine Opticon system for melting ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; Bio-Rad, 170-6516) for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... and plates were sealed with the PX1 PCR Plate Sealer (Bio-Rad) before proceeding with RT-PCR on the C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... ScRNA-Seq libraries were prepared using SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina/Bio-Rad) according to manufacturer’s manual ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were washed and incubated with mouse anti-His (Bio-Rad MCA-1396; 1:1000) followed by horseradish peroxidase (HRP)-conjugated goat anti-mouse secondary antibody (MerckMillipore AP124P ...
-
bioRxiv - Genomics 2019Quote: ... 384-well plates (BioRad) are prepared as follows ...
-
bioRxiv - Genomics 2020Quote: ... using plate reader (Biorad). Protein lysates (20-30ug ...
-
bioRxiv - Bioengineering 2019Quote: ... or qPCR plates (Biorad) on the Aria II and SH800 using associated 96-well plate gantries for each instrument ...
-
bioRxiv - Biochemistry 2020Quote: ... The resulting ddPCR droplets were transferred to a clean 96-well plate and the plate was sealed with a foil lid using a thermal plate sealer from Bio-Rad Laboratories prior to PCR amplification using a Bio-Rad C1000 touch thermal cycler with deep wells ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... the plate was sealed with adhesive optical plate sealing film (Microseal, Bio-Rad) and placed in a Synergy H1 microplate reader (BioTek ...
-
bioRxiv - Genomics 2020Quote: ... The plate was heat sealed with the PX1 PCR Plate Sealer (Bio-Rad) and subsequently placed in the C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The plate was sealed with adhesive optical plate sealing film (Microseal, Bio-Rad) and placed in a Synergy H1 microplate reader (BioTek ...
-
bioRxiv - Microbiology 2023Quote: ... The sample plate was heat-sealed on a PX1 PCR plate Sealer (BioRad) and thermocycling was performed on a C1000 Touch with a Deep Well Reaction Module (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... the plate was heat-sealed using the PX1 PCR Plate Sealer (BioRad #1814000) and PCR was performed with a pre-step of 95 C for 5 minutes followed by 40 rounds of amplification with 60C ...