Labshake search
Citations for Bio-Rad :
201 - 250 of 8193 citations for Estrone 3 Glucuronide E1G ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Microbiology 2020Quote: ... 10.5 μl template DNA and 1 μl respective primer pairs (200 nM final concentration, supplementary table 1) were mixed and distributed into a 96-well qPCR plate (Bio-Rad). The plate was incubated 10 min at room temperature to digest the target DNA before droplets were generated in an Automated Droplet Generator (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 µl HeLa lysate was preincubated with 1 µl of accessory protein for 10 min at room temperature in PCR plates (HSP9601, Bio-Rad). Reaction was started by adding 2 µl reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... 550 µl of the assembled community was added into each well of the “Community Plates Day 1” with an epMotion 96 (Bio-Rad) semi-automated electronic 96 channel pipette ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR plate was subsequently heat-sealed with pierceable foil using a PX1™ PCR plate sealer (Bio-Rad) and then amplified in a LifeEco thermal cycler (Bioer ...
-
bioRxiv - Biophysics 2021Quote: ... The PCR plate was subsequently heat-sealed with pierceable foil using a PX1 PCR plate sealer (Bio-Rad, USA) and then amplified in a Veriti thermal cycler (Applied Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... Droplets were transferred to a 96-well PCR plate and heat-sealed using PX1 PCR Plate Sealer (Bio-Rad). PCR amplification was performed with the following conditions ...
-
bioRxiv - Microbiology 2023Quote: ... the OD600 of the 96-well plate was recorded by a plate reader (iMarkTM microplate absorbance reader, Bio-Rad). The minimum inhibitory concentration (MIC ...
-
bioRxiv - Neuroscience 2024Quote: ... the plate was analyzed using a Bio-Rad Bio-Plex 200 plate reader (Bio-Rad Laboratories, Hercules, CA, USA) and analyzed using Bio-Plex Manager software (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Bioengineering 2022Quote: Total RNA was purified with 1) Aurum Total Mini Kit (Bio-Rad) using the spin column method with DNase 1 (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad; Cat#1864022) and same set of primers and probe used for SIV plasma viral load quantification ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of RNA was reverse transcribed (iScript cDNA Synthesis Kit (BioRad)) and the cDNA was purified with QiaQuick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2022Quote: ... total RNA (1 μg) was reverse transcribed using the SuperScript kit (BioRad), and the Real-time PCR was performed in three technical replicates using the Applied Biosystems StepOnePlus Real-Time PCR system and Fast SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Genomics 2023Quote: ... then embedded in 1% low-melt agarose blocks (BioRad Plug Kit #1703591) to preserve DNA integrity ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected by using a 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad, Hercules, CA) in 5% milk TBST (Tris buffer saline plus Tween-20) ...
-
bioRxiv - Microbiology 2022Quote: ... 300 nM concentration of each primer targeting the viral DNA substrate (5’- AGCGTGGGCGGGAAAATCTC-3’) and the indicated target DNA (table 1) and 1X iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories). The qPCR cycling conditions for quantifying INS activity included an initial incubation at 95°C for 3 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... The PVDF membrane was then washed 3 × 10 min with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse (diluted 1:20,000; Bio-Rad, Hercules, CA) secondary antibody for one hour at room temperature followed by 6 × 10 min washes with TBST and detection using the Radiance Plus chemiluminescence substrate (Azure Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Biochemistry 2024Quote: ... were annealed at a ratio of 3:1 molar ratio Incubated at 93°C for 3 minutes and slowly cooling down in C1000 Touch™ Thermal Cycler (Bio-Rad). The pre-annealed RNA-TS (32 µM ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were prepared for gel electrophoresis by adding a volume containing 20 ug protein to 3 uL 1 M DTT and 7.5 μL 4X Laemmli sample buffer (BioRad Cat. No. 1610747) and topping up to 30 μL with deionized water ...
-
bioRxiv - Biophysics 2023Quote: ... Single-stranded cDNA was synthesized from 1 µg of total RNA as template using a commercially available kit (iScript cDNA Synthesis Kit, Biorad). RT-qPCR analysis of nascent mRNA abundance was performed in duplicate using iQ SYBR Green Supermix (Biorad #1708880 ...
-
bioRxiv - Molecular Biology 2023Quote: ... One aliquot was used to synthesize single-stranded cDNA starting from 1 µg of total RNA using a commercially available kit (iScript cDNA Synthesis Kit, Biorad).
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Immunology 2021Quote: ... beads were resuspended in a reading buffer 5 min under agitation (800 rpm) on the plate shaker then read directly on a Luminex Bioplex 200 plate reader (Biorad). Average MFI from the baseline samples were used as reference value for the negative control ...
-
bioRxiv - Genetics 2022Quote: ... Approximately 43µl of the newly formed droplet solution were transferred into a ddPCR 96-well plate and then sealed at 180°C for 5 seconds in the PX1 PCR Plate Sealer (BioRad). PCR was carried out with the following conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... Pipetting steps were performed using the liquid-handling robots Dragonfly or Mosquito HV (SPT Labtech) using 384 well-plates and PCR reactions were carried out on a 384-plate Thermal Cycler (BioRad). Illumina sequencing of the resulting libraries was performed by Novogene (https://en.novogene.com/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 96-well PCR plates were sealed with peelable foil heat seals at the PCR plate sealer machine (PX1TM, Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... and the absorbance value of each well was measured at a wavelength of 450 nm on microplate ELISA reader (Microplate Manager v5.2.1 software, Bio-Rad Laboratories).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... aliquots of the samples were organized in a 96-well PCR plate and reverse transcribed to cDNA using the iScript™ Reverse Transcription Supermix kit and protocol (Bio-Rad Laboratories, Hercules, CA). The resulting 96-well plate with cDNA was used as source quantitative real-time polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... macrophages were plated in a 24-well plate containing cover slips and incubated with the Magic Red cathepsin B substrate (1/250) (Bio-Rad, ICT938) for 2h ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.5 μL of forward and reverse primers (see Supplementary Table 1 for primer sequences) for the genes of interest were combined in a 384-well plate (Bio-Rad, HSP3805). The plate was run on a CFX384 Real Time PCR Detection System using the following program ...
-
bioRxiv - Developmental Biology 2024Quote: ... see Supplementary Table 1 for primer sequences) and diluted to 20 μL with nuclease free water in a 384-well plate (Bio-Rad, HSP3805). The plate was run on a Bio-Rad CFX384 Real Time PCR Detection System with the following program ...
-
bioRxiv - Genetics 2021Quote: ... and semi-skirted PCR plates (Bio-Rad, 2239441).
-
bioRxiv - Genetics 2021Quote: ... and semi-skirted PCR plates (Bio-Rad, 2239441). All qRT-PCR data was normalized to quantification of nos-3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Plates were sealed with Microseal F (Biorad, MSF1001), centrifuged at 4ºC for 1min at 2000 rpm and stored at −80ºC.
-
bioRxiv - Microbiology 2019Quote: ... Cover plate with Microseal ‘B’(Biorad, MSB-1001). Give the plate a quick spin to collect all liquid at the bottom (Sorvall or Allegra centrifuges ...
-
bioRxiv - Microbiology 2019Quote: ... Cover plate with Microseal ‘A’ (Biorad, MSB-5001). Make sure to press well on each well ...
-
bioRxiv - Immunology 2021Quote: ... flat-bottom 96 well plate (Bio-Rad #171025001). The beads were washed once ...
-
bioRxiv - Immunology 2021Quote: ... Hard-shelled 96-well reaction plates (Bio-Rad) were sealed with adhesive film (Bio-Rad ...
-
bioRxiv - Bioengineering 2021Quote: ... was transferred to 96-well plates (Bio-Rad) and PCR was done on C1000 Touch thermal cycler (Bio-Rad) ...
-
bioRxiv - Bioengineering 2020Quote: ... using Criterion Blotter with Plate Electrodes (Biorad, #1704070). The membranes were blocked with 2% Blotting-Grade Blocker (Biorad,1706404 ...
-
bioRxiv - Biochemistry 2021Quote: ... in 96-well plates (Hard-Shell, Bio-Rad) sealed with optically clear Microseal ‘B’ Adhesive Sealer (Bio-Rad) ...