Labshake search
Citations for Bio-Rad :
901 - 950 of 5108 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 µL 2X SSOAdvanced SYBR Green PCR mix (BioRad), and 10 µM each of primer ...
-
bioRxiv - Neuroscience 2021Quote: ... by CFX384 Touch Real-Time PCR detection system (BioRad). Primers were optimized and designed to hybridize with different exons ...
-
bioRxiv - Microbiology 2021Quote: ... a CFX Connect RealTime PCR Detection system (Bio-Rad) or a 7500 Real Time PCR System (Applied Biosystems).
-
bioRxiv - Biochemistry 2021Quote: ... A 96-well thin-wall PCR plate (Bio-Rad) was set up with each well containing 10-40☐μM of protein in 20☐mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... using SYBR Green PCR Master Mix (Bio-Rad, 1725120) and relevant primers (Table 1) ...
-
bioRxiv - Cell Biology 2020Quote: ... and cycled on a Real-Time PCR System (Biorad). β-actin was used as an internal control and all reactions were run in triplicate ...
-
bioRxiv - Cell Biology 2019Quote: ... on the CFX96 qRT-PCR apparatus (Bio-Rad Laboratories) as described (Hobbs et al ...
-
bioRxiv - Genetics 2020Quote: ... qRT-PCR was performed with SYBR Green mix (BIORAD) with a Lightcycler96® (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... and the CFX384 Real Time PCR System (Bio-Rad). Relative enrichment of the targets was calculated by normalizing the signals of the precipitated DNA to those of the input samples ...
-
bioRxiv - Immunology 2021Quote: ... PCR was run on a CFX96 thermal cycler (BioRad) with a program of one cycle of denaturation at 95℃ for 2 min ...
-
bioRxiv - Immunology 2020Quote: ... q-PCR was performed using iTaq SYBR green (BioRad) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed in an CFX96™ (Bio-Rad) with the following steps ...
-
bioRxiv - Biochemistry 2022Quote: ... A CFX384 Touch Real-Time PCR Detection System (BioRad) was used with the following cycling parameters ...
-
bioRxiv - Biochemistry 2022Quote: ... in a CFX384 Touch Real-Time PCR system (BioRad) with the following conditions ...
-
bioRxiv - Bioengineering 2022Quote: Real-Time PCR Detection System (Biorad, CFX96 or CFX384)
-
Driving Osteocytogenesis from Mesenchymal Stem Cells in Osteon-like Biomimetic Nanofibrous ScaffoldsbioRxiv - Bioengineering 2022Quote: ... A CFX96™ IVD Real-Time PCR system (BioRad) was used with a thermal cycle of 50 °C for 2 min ...
-
bioRxiv - Cell Biology 2022Quote: ... which was running by Bio-rad CFX Connect Fluorescence quantitative PCR instrument (Bio-rad, US). The relative circulation number of the target gene was detected ...
-
bioRxiv - Molecular Biology 2022Quote: ... using CFX96 Touch Real-Time PCR Detection System (BIORAD) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and quantitative PCR (qPCR) analysis (Bio-Rad, Hercules, CA). Libraries were pooled and sequenced on the NovaSeq 6000 instrument (Illumina Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... in the CFX96TM Real-Time PCR System (Bio-Rad). The sequences of all primers are listed in Table S1.
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed using Sso EvaGreen Supermix (BioRad), adding 60ng of template DNA per reaction and using mtDNA and nucDNA specific primers (400nM final concentration) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Different mRNAs were detected by RT-PCR (BioRad, 1725151) using 1 ng of total RNA ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 5 µL 2X SSOAdvanced SYBR Green PCR mix (BioRad), and 10 µM each of primer (total volume ...
-
bioRxiv - Neuroscience 2022Quote: Droplet digital PCR reagents were purchased from Bio-Rad and reactions were set up as follows.
-
bioRxiv - Physiology 2022Quote: ... using a CFX384 real-time PCR machine (Bio-Rad). Thermal cycling conditions were 50°C for 2 min and 95°C for 2 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... and used for PCR in a thermocycler (BioRad, Eppendorf). Finally ...
-
bioRxiv - Microbiology 2022Quote: ... and CFX96 Touch Real-Time PCR Detection System (Biorad). The primer set for qPCR is ‘GGGGTGCTATCAGAGGCATC’ and ‘TAGGACCCTTGGTACCGGAG’.
-
bioRxiv - Plant Biology 2022Quote: ... and a CFX96 Real-Time PCR system (Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... A Quantitative PCR Bio-Rad T100 Thermal Cycler (Biorad) was used for a reverse transcription reaction ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The CFX96 Touch Real-Time PCR Detection System (Biorad) was used and quantification was performed with the DDCt method ...
-
bioRxiv - Bioengineering 2022Quote: ... on a real-time PCR machine (Bio-Rad, CFX96). To evaluate the expression of LDL-R and SREBP-2 genes ...
-
bioRxiv - Cancer Biology 2022Quote: ... into 384-well hard-shell PCR plates (Biorad HSP3901) using a Dragonfly liquid handler (STP Labtech) ...
-
bioRxiv - Cell Biology 2022Quote: ... The CFX96 Touch Real-Time PCR Detection System (Biorad) was used ...
-
bioRxiv - Microbiology 2023Quote: ... on a CFX384 Touch Real-Time PCR system (BIORAD). qPCR efficiency (E ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CFX384 Touch Real-Time PCR System (Bio-Rad) was used for quantification and the CFX Maestro software (Bio-Rad v4.1.2433.1219 ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... on a CFX96 Real Time PCR machine (Bio-Rad) using a standard protocol ...
-
bioRxiv - Genetics 2023Quote: ... Quantitative PCR was performed on a MyiQ (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Genomics 2023Quote: ... The PCR was run in a thermocycler (BioRad, USA) with the following profile ...
-
bioRxiv - Microbiology 2023Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... in iCycler IQ 96 well PCR plates (Bio-Rad) on a BioRad iCycler equipped with an iCycler iQ Detection System ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was conducted by using SYBR Green (BioRad). The relative expression of each gene was normalized against the internal control gene (GAPDH) ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a CFX384 RT-PCR detection system (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... CFX Connect Real-Time PCR detection system (Bio-Rad) was used for measurement and analysis.
-
bioRxiv - Molecular Biology 2023Quote: ... on a CFX384 Real-Time PCR Detection System (BioRad) using the following thermal cycling conditions ...
-
bioRxiv - Bioengineering 2023Quote: ... All primers were qPCR Prime PCR Assays (Bio-Rad), and the unique IDs for each primer set are provided in Supplemental Table 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with CFX-96 Real-Time PCR Detection System (BioRad). The primers used in this study targeting histone H4C5 are ...
-
bioRxiv - Plant Biology 2023Quote: ... in a 96-well white PCR plate (BioRad #HSP9601) according to the manufacturer’s instructions ...