Labshake search
Citations for Bio-Rad :
801 - 850 of 5108 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Virus quantification of KO/activation pool was done by droplet digital PCR (ddPCR) using QX200 Droplet Digital PCR System (Bio-RAD, #1864001).
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative RT-PCR was performed in triplicate with custom-designed oligos using the CFX96 Real-Time PCR Detection System (Bio-Rad, USA) using the Titan HotTaq EvaGreen qPCR Mix (BIOATLAS) ...
-
bioRxiv - Neuroscience 2022Quote: ... thereafter qRT-PCR was performed in triplicate with custom designed oligos (Table S3) using the CFX96 Real-Time PCR Detection System (Bio-Rad, USA). using the Titan HotTaq EvaGreen qPCR Mix (BIOATLAS) ...
-
bioRxiv - Microbiology 2023Quote: ... for real-time PCR analysis of SARS-CoV-2 E genes using the iTaq Universal Probes One-Step RT-PCR Kit (Bio-Rad, USA) and the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems™ ...
-
bioRxiv - Genomics 2022Quote: ... Quantitative Real-time PCR of SV genes was then performed with a Bio-Rad CFX384 Real-Time PCR Detection System (Bio-Rad, USA) using Hifair UNICON Universal Blue qPCR SYBR Green Master Mix (Yeasen Biotech Co. ...
-
bioRxiv - Plant Biology 2023Quote: ... was performed utilizing ExcelTaq™ 2X Q-PCR Master Mix (SYBR, ROX; TQ ID1110, SMOBIO, Taiwan) with a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA). The expression of the PcActin gene was normalized to elongation factor-1a of N ...
-
bioRxiv - Bioengineering 2023Quote: ... Genotyping PCR was performed using a primer set to detect the GFP sequence using conventional PCR (T100; Bio-Rad, Hercules, CA, USA). To determine the copy number of the transgene ...
-
bioRxiv - Zoology 2023Quote: ... quantitative R T–PCR was performed with a Bio-Rad CFX96™ Real-time PCR Detection System (Bio-Rad, Hercules, CA, USA) according to standard protocols and cycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR was performed using SYBR Green (Bio-Rad) and primers targeting the Chr12 gene desert (Active Motif ...
-
bioRxiv - Plant Biology 2020Quote: ... was used for the qRT-PCR reactions (BioRad iQ5) and miRNA was quantified (Varkonyi-Gasic et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... on CFX96 Touch Real-Time PCR System (Bio-Rad). Results were analyzed using the 2ΔΔC(t ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a CFX96 Real-Time PCR system (BIO-RAD). Expression values were normalized to rpL23 transcript levels ...
-
bioRxiv - Cell Biology 2020Quote: ... Data of Q-PCR are calculated by Bio-Rad software CFX3.1 and derived from three independent experiments.
-
bioRxiv - Neuroscience 2020Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad). Rpl19 mRNA levels were used for normalization and the ΔΔCt method (70 ...
-
bioRxiv - Cell Biology 2022Quote: ... The RT-PCR results were analysed by Bio-Rad CFX manager ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid were linearized using PCR (iProof Bio-Rad 1725310). 5 μl of PCR product was loaded onto an agarose gel to determine size and purity ...
-
bioRxiv - Molecular Biology 2020Quote: ... into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest or Mantis liquid handler (Formulatrix).
-
bioRxiv - Bioengineering 2022Quote: ... Real-Time PCR Detection System (Bio-Rad Laboratories, California) was used to detect mRNA expression of target genes ...
-
bioRxiv - Biophysics 2022Quote: ... A CFX ConnectTM Real-Time PCR System (Bio-Rad) was used to perform Real-Time PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... on a CFX384 Real-Time PCR Detection system (Biorad). Expression of each gene was normalized to the housekeeping gene ALG9 and expressed as fold change after 1.5h rapamycin treatment calculated using delta-delta Ct method.
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR was performed using iTaq SYBR green (BioRad) following the instructions of the manufacturer and normalized on TBP ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CFX384 Touch Real-Time PCR Detection Systems (BioRad). Relative levels of transcript expression were quantified by the comparative ΔΔCt method with normalisation to RPL19 levels ...
-
bioRxiv - Immunology 2019Quote: ... The CFX384 TouchTM Real-Time PCR Detection System (BioRad) was used to obtain the raw CT values ...
-
bioRxiv - Molecular Biology 2019Quote: ... the QX200™ Droplet Digital™ PCR System (BIORAD) was used according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... on a CFX Connect Real-Time PCR machine (Biorad). The following primers for Fbxo7 (5’-CGCAGCCAAAGTGTACAAAG ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR were run on either a T100 (Bio-rad) or a SimpliAmp (Life Technologies ...
-
bioRxiv - Systems Biology 2019Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad) were used for quantitative PCR ...
-
bioRxiv - Biochemistry 2019Quote: ... an integrated PTC-200 PCR machine (Bio-Rad Laboratories), stacks and hotels for microplates ...
-
bioRxiv - Cancer Biology 2019Quote: ... using CFX384 Real-Time PCR Detection System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... The C1000 Real-Time PCR instrument (Bio-Rad, USA) was used for qRT-PCR ...
-
bioRxiv - Genomics 2019Quote: ... in CFX96TM Real-Time PCR Detection system (Bio-Rad). Ribosomal protein S14 (RPS14 ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: ... and a Real-Time PCR Detection System (Bio-Rad). The cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative PCR reactions using SsoFast EvaGreen Supermix (Bio-Rad) were performed in a CFX384 real time PCR system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2019Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). Primer sequences are available upon request.
-
bioRxiv - Molecular Biology 2019Quote: ... using the iQ5 real time PCR system (Bio-Rad) starting with activation at 95°C for 2 min ...
-
bioRxiv - Microbiology 2021Quote: ... using CFX96 Real-Time PCR Detection System (Bio-Rad) and 500 nM SARS-Cov-2 nsp1-specific CCTCAACTTGAACAGCCCTATG forward and GAATGCCTTCGAGTTCTGCTAC reverse primers.
-
bioRxiv - Genetics 2019Quote: ... Quantitative PCR was performed using SYBR green (Bio-Rad) to access the frequency of deletion and inversion of the target sequences in bulk cell populations ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 µL 2X SSOAdvanced SYBR Green PCR mix (BioRad), and 10 µM each of primer ( total volume ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed using SYBR green reagents (BioRad) and the ΔΔCT method (Applied Biosystems 1997) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The CFX96 Real-Time PCR Detection System (Bio-Rad) was used to monitor fluorescent intensity during amplification ...
-
bioRxiv - Molecular Biology 2021Quote: ... in a CFX Connect Real-Time PCR thermocycler (Biorad) Relative quantitation was calculated with the 2-ΔCt method where relative enrichment over the adjusted DNA input was used for data representation.
-
bioRxiv - Cancer Biology 2021Quote: The QX200 Droplet Digital PCR System (Bio-Rad Laboratories) was used for absolute quantification of mRNA expression in MCC tumor ...
-
bioRxiv - Cell Biology 2021Quote: ... prior to real time PCR (iCycler; BioRad, Hercules, CA). 25-μl amplification reactions contained primers (0.5 μM) ...
-
bioRxiv - Bioengineering 2021Quote: ... SYBR-Green PCR Master- mix (Bio-Rad, Hercules, CA) was used for qRT-PCR experiments on a Step-One Real-time PCR System (Thermo Fisher ...
-
bioRxiv - Neuroscience 2019Quote: The QX200 Droplet Digital PCR (ddPCR) system (Bio-Rad) was used to provide absolute measurements of C9orf72 mRNA ...
-
bioRxiv - Biochemistry 2021Quote: ... using the SYBR-Green PCR Master Mix (Bio-Rad). Quantitative PCR was performed in triplicate ...
-
bioRxiv - Microbiology 2020Quote: ... a Mycycler™ Thermal Cycler PCR system (BioRad, USA) was used ...
-
bioRxiv - Microbiology 2021Quote: ... on a MyiQ™ Real time PCR system (Biorad). The data generated by qPCR assays were normalized using the average value of the HBSS treatment control group.
-
bioRxiv - Neuroscience 2021Quote: ... in iQ5 Real-Time PCR Detection System (Bio-Rad). A portion of the m-hCDKL5 (Fw 5’-CTTAAATGCAGACACAAGGAAACAC-3 ‘ ...
-
bioRxiv - Plant Biology 2020Quote: ... in a CFX96 Real-Time PCR system (Bio-Rad) as described (Zhou et al. ...