Labshake search
Citations for Bio-Rad :
8301 - 8350 of 9407 citations for Mouse Interleukin 1 Family Member 10 IL1F10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... or Goat Anti-Rabbit IgG (H L)-HRP Conjugate (1:1000; Bio-Rad; Catalog # 172-1019) in TBS-T for 1 hr at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7) for 30 min to 1 hr then assembled in a dot blot apparatus (BioRad). After washing with 100 μl TE buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Biochemistry 2021Quote: ... the detergent was removed by adding 0.5 g mL-1 (w/v) Bio-Beads (Bio-Rad) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The assay medium was prepared by diluting 1 volume of alamarBlue dye reagent (BUF012A; Bio-Rad) in 9 volumes of growth medium ...
-
bioRxiv - Microbiology 2020Quote: ... loaded onto a lab-made 8% TBE gel (Acrylamide/Bis solution 37.5:1, Bio-rad, 1610148), run at 200V for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... The following secondary antibodies were used: goat anti-rabbit HRP (1:5000, Bio-Rad: 170-5046) and goat anti-mouse HRP (1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... coli strain S17-1 using a Gene Pulser Xcell™ (Bio-Rad, Hercules, CA, United States) with the conditions of 2.5kV ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA (1 μg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-conjugated Goat Anti-Rabbit IgG (H+L) (1:1000, 170-6515, Bio-Rad, CA, USA) or Goat-anti-Mouse IgG (1:1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... qPCRs were then performed with 1 μl of cDNA using Universal SYBR green Supermix (BIO-RAD). Primer sets used for real-time PCR analysis are qcopA forward (CAATACCCTGGTGGTCGATAAAAC ...
-
bioRxiv - Biochemistry 2022Quote: ... at 1:3000 dilution and with the ladder conjugate (Precision Protein StrepTactin-HRP Conjugate, Bio-Rad) at 1:5000 dilution ...
-
bioRxiv - Genetics 2022Quote: ... The membranes were blocked with 1x Tris buffered saline with 1% casein (Bio-Rad, Cat #: 1610782) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Boiled samples were diluted 1:1000 and subsequently used as templates for IQ SYBR (Bio-Rad) qPCR reactions ...
-
bioRxiv - Genomics 2022Quote: 1 µg of total RNA was reverse transcribed using iScript reverse transcription supermix (Biorad, Solna, Sweden). RT-qPCR was performed using a LightCycler 96 and the SYBR green master mix (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA (1 µg) was reverse-transcribed using the iScript™ Reverse Transcription Supermix (Bio-Rad) as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: ... Electroporation was performed using a cuvette with a width of 1 mm and an electroporator (Biorad) with the settings ...
-
bioRxiv - Biophysics 2020Quote: ... Nanodisc reconstitution was achieved by incubation with 0.5 - 1 mL Bio-Beads SM-2 (Bio-Rad) for 16 hours at 4°C under constant rotation ...
-
bioRxiv - Neuroscience 2021Quote: ... at 100 V for 1 h at room temperature using Mini Trans-Blot Cell system (Biorad). Fast Green staining was used to detect the whole protein content on the membrane ...
-
bioRxiv - Biochemistry 2021Quote: ... they were detected with goat anti-rabbit-HRP antibody (Bio-Rad catalog #170-6515; 1:10,000) diluted in TBST with 2% milk ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 412 nm (ε=13.6 mM−1cm−1) in a microplate reader (iMARK™, Bio-Rad). The results were normalized to cell proliferation.
-
bioRxiv - Microbiology 2021Quote: ... Protein was applied at 1 ml/min to a 5 ml ceramic hydroxyapatite column (BioRad BioscaleTM) in the dialysis buffer ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: ... Total RNA (1 μg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... and 1% Triton X-100) and resuspended in 30 µl of SDS sample buffer (Bio-Rad) and boiled for 10 minutes ...
-
bioRxiv - Genetics 2022Quote: ... 1 ug of RNA was reverse-transcribed using iScript RT Supermix (Bio-Rad 1708841, Hercules, CA). qPCR was performed using SsoAdvanced SYBR Green Super Mix (Bio-Rad 1725270 ...
-
bioRxiv - Microbiology 2022Quote: ... a 1:20,000 dilution of HRP-conjugated goat anti-rabbit secondary antibody (Bio-Rad, Hercules, CA), was incubated with the membranes at room temperature for 1 h ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA (1 µg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... The plasmids were evaluated on a 1% agarose gel and displayed on transilluminator (BioRad city, country). The amplification products were finally sequenced in both directions (T7 and SP6).
-
bioRxiv - Molecular Biology 2020Quote: ... A total of 1 µg of RNA was reverse-transcribed using iScript Reverse Transcription Supermix (Biorad) and qPCR (45 cycles ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed in monomer solution (1 x PBS, 2 M NaCl, 2.5% acrylamide (Bio-Rad), 0.15% Methylenbisacrylamide (Santa Cruz) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1 µg RNA was reverse transcribed using 5X iScript Reverse Transcription Supermix (BioRad, Mississauga, ON, Canada). A non-reverse transcription (NRT ...
-
bioRxiv - Immunology 2020Quote: ... and an X-OMAT 2000A processor (Kodak) (caspase-1) or a ChemiDoc Touch Imaging System (BioRad) (actin).
-
bioRxiv - Immunology 2020Quote: ... and purified by size exclusion chromatography on a Enrich SEC 650 1 x 300 column (Biorad), equilibrated in 10 mM HEPES (pH 7.2 ...
-
bioRxiv - Systems Biology 2020Quote: ... for the primary and 1:10,000 goat anti-rabbit HRP-labeled antibody (170-5046, Bio-Rad) for the secondary.
-
bioRxiv - Cell Biology 2019Quote: ... after 1 min UV-induced photoactivation and imaging using a Gel Doc EZ Imager (Bio-Rad).
-
bioRxiv - Bioengineering 2019Quote: ... and a 1:10000 dilution of ‘Immun-Star Goat Anti-rabbit-HRP conjugate’ (170-5046, Biorad) as secondary antibody ...
-
bioRxiv - Cell Biology 2019Quote: ... RT-qPCR was performed using 1-Step Quantitative Reverse Transcription PCR from RNA (Biorad, Hercules, CA) following the manufacturer’s description ...
-
bioRxiv - Genetics 2021Quote: ... rat anti CD68 (1:200; clone FA-11/MCA1957, Bio-Rad Laboratories Inc, Hercules, CA, USA); rabbit anti LAMP1 (1:200 ...
-
bioRxiv - Biochemistry 2021Quote: ... and electroporated (exponential, 25 μF, 1 kV, 400 Ω) using a Gene Pulser Xcell (Bio-Rad). Immediately after the pulse 1 mL pre-warmed BM medium was added and incubated at 30 °C for 90 min ...
-
bioRxiv - Immunology 2021Quote: ... and TaqMan Fast Virus 1-step Master Mix) using CFX-96 (Bio-Rad, Hercules, CA, USA).
-
bioRxiv - Bioengineering 2022Quote: ... in PBS at 40°C and loaded into the wells of preformed 1% agarose (Bio-Rad) phantoms in PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 lane was kept for molecular weight markers (Precision Plus Dual Color Protein Standard, Bio-Rad). Samples after electrophoresis were transferred to PVDF membranes (Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... secondary horseradish-peroxidase-conjugated goat anti-rabbit antibody (1:2,000; Bio-Rad, Cat# 166-2408EDU, RRID:AB_11125345), secondary horseradish-peroxidase-conjugated goat anti-mouse antibody (1:2,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... A GS-800 calibrated densitometer with Quantity One 1-D Analysis Software 4.6 (Bio-Rad Laboratories) was used for quantitative analysis of protein levels ...
-
bioRxiv - Neuroscience 2022Quote: ... Western blotting was performed using the following antibodies: anti-vinculin (MCA465GA, Bio-Rad; 1:1,000 dilution), anti-FOSB (2251 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Second antibodies were added for another 1 h and detected with Clarity Western ECL Substrate (Biorad). Immunoreactive bands were exposed in an automatic X-ray film processor ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration in each lysate sample was quantified with Quick Start Bradford 1× Dye (BioRad) to equalise protein concentrations across the samples before SDS-PAGE and immunoblotting.
-
bioRxiv - Physiology 2022Quote: ... 1 µg RNA was reverse transcribed using 5X iScript Reverse Transcription Supermix (Bio-Rad, Mississauga, Canada).
-
bioRxiv - Microbiology 2022Quote: ... Commercial antibodies were used for β-tubulin (clone YL1/2, Bio-Rad, Watford, UK; 1:5000), β-actin (Abcam ab8227 ...