Labshake search
Citations for Bio-Rad :
7951 - 8000 of 9407 citations for Mouse Interleukin 1 Family Member 10 IL1F10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... starting from 1 μ were designed through Beacon Designer 2.0 Software (Bio-Rad Laboratories). CLUH primers sequences were TACATCATGGGCGACTACGC (forward primer ...
-
bioRxiv - Genetics 2021Quote: ... absorbance at 254 nm was measured and recorded (Econo UV monitor EM-1, Biorad), using the Gradient Profiler software (version 2.07) ...
-
bioRxiv - Neuroscience 2021Quote: ... We immunopanned RGCs from retinal suspension using Thy1.2 antibody (CD90, 1:800, Bio-RAD) and 0.02% BSA (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... and 1 ml Luminol/enhancer solution (Clarity™ Western ECL, BIORAD, Les-Ulis, France) and observed using ChemiDoc (ChemiDoc™ Imaging Systems ...
-
bioRxiv - Cell Biology 2021Quote: ... was used at 1:10,000 and developed with Clarity Western ECL Substrate (Bio-Rad). mRFP1 from phagolysosomes was identified by the increased gel migration compared to native mRFP1 (Katayama et al. ...
-
bioRxiv - Immunology 2020Quote: ... and cDNA synthesis was performed using 1 μg of total RNA (iScript, Bio-Rad). qPCR was performed with the following gene-specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... Lysates were boiled for 5 min in 1 x Laemmli Sample Buffer (Bio-Rad) containing 5% β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were mixed 1:4 with 4X Laemmli buffer (Bio-Rad, Lunteren, Netherlands) containing 10% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... The 20 μL qPCR mix contained 1× IQ™ SYBR Green Supermix (BIO-RAD), 0.25 μM of each primer and 1 μL of 1:10 diluted DNA from individual gradient fractions ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg of RNA was reverse transcribed with iScript™ reverse transcription (Biorad, 1708841). Quantitative polymerase chain reaction was performed using Sso Advanced Universal SYBR Green Supermix (Bio-Rad 1725274 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Revelation was performed using corresponding antibody (Table 1) with ECL Clarity Max (Biorad, 1705062). Images were acquired with ChemiDoc camera (Biorad ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 μg of total RNA was reverse-transcribed using iScript RT Supermix (Bio-Rad). A real-time PCR was run in triplicate using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... along with Rhodamine-conjugated ɑ-GAPDH human Fab fragment (1:1000, Bio-Rad, 12004168). The blots were imaged on the ChemiDoc MP system and quantified using Image Lab software (Bio-Rad).
-
bioRxiv - Biophysics 2022Quote: ... Samples (1 mg of protein per well) were loaded onto a protein gel (BioRad, 4-15% Criterion TGX Stain-Free Precast Gel) ...
-
bioRxiv - Immunology 2022Quote: ... Secondary antibodies: goat anti-rabbit HRP (BioRad 1706515 or Invitrogen 65-6120, 1:5,000), anti-mouse HRP (Santa Cruz sc-525409 ...
-
bioRxiv - Systems Biology 2023Quote: ... The secondary antibody used was 1:5000 HRP goat anti-rabbit (Bio-Rad #1706515).
-
bioRxiv - Genetics 2022Quote: ... suspended myoblasts were mixed with melted 1% UltraPure Low Melting Point Agarose (Bio-Rad) at 37°C to form plugs ...
-
bioRxiv - Microbiology 2022Quote: ... cell pellet was gently resuspended in 200 μL of 1 X Laemmli Buffer (Biorad) supplemented with β-mercaptoethanol at a final concentration of 2.5 % ...
-
bioRxiv - Plant Biology 2024Quote: ... was used for gel migration in 1 X Tris/Glycine/SDS Buffer (Bio-Rad). Protein transfer to nitrocellulose membranes (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... HRP signal was detected in 9:1 mix of Clarity:Clarity Max ECl reagent (BioRad) and captured using a Chemidoc Touch imager (BioRad).
-
bioRxiv - Genetics 2024Quote: ... This solution was rapidly combined with 40 % acrylamide (37.5:1 mono:bis) solution (Bio-Rad) (sufficient for a final concentration of 2 %) ...
-
bioRxiv - Genetics 2024Quote: ... The primary antibodies (NF-kB, #8242 Cell Signaling, 1:1000; CD3, MCA-1477 Biorad, 1:100 ...
-
bioRxiv - Genomics 2024Quote: ... and counted (1:4 dilution) with TC20 Automated Cell Counter (Bio-rad cat. #1450102). Cells were fixed using Parse Biosciences’ Nuclei Fixation Kit v1 (Parse Biosciences cat ...
-
bioRxiv - Genetics 2023Quote: ... membranes were incubated in secondary goat anti rabbit antibody (1:10000, Bio-Rad, 1706515) for one hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... at 1:10,000 and goat anti-rabbit HRP-conjugated (1721019, Bio-Rad, RRID: AB_11125143) at 1:10,000 ...
-
bioRxiv - Biophysics 2023Quote: ... The purity of 12mer arrays was confirmed using APAGE (2% acrylamide, 1% Biorad agarose) gels stained with SyBr Gold (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 μg RNA was reverse-transcribed with Iscript Supermix (Bio-rad). cDNA was then used to amplify the target genes by SYBR Green PCR Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... Samples were mounted on a glass slide with 1% low-melt agarose (Bio-Rad) and submerged in de-ionized water.
-
bioRxiv - Molecular Biology 2022Quote: ... Final elution was performed by resuspension in 1 x laemmli buffer (Bio-rad, 1610747) and heating at 90 °C for 5 minutes
-
bioRxiv - Cell Biology 2023Quote: ... Bio-Plex Pro Human Inflammation Panel 1 IL-28A / IFN-λ2 (Bio-rad, 171BL022M), Bio-Plex Pro Human Inflammation Panel 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rat anti-CD11b (Bio-Rad, #MCA711G, 1:500), and rabbit anti-Iba1 (Wako ...
-
bioRxiv - Immunology 2023Quote: ... Sections were incubated with an anti-F4/80 antibody (1:100 dilution, Bio-Rad, cat ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rat anti-CD11B (1:100; #MCA711G Bio-Rad), rabbit anti-IBA-1 (1:100 ...
-
bioRxiv - Microbiology 2023Quote: ... The resin-lysate mixture was poured into a 1-cm separation column (Bio-Rad), the resin was allowed to pack ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature using ECL solution Clarity Max (Bio-Rad Laboratories) and fluorescence-imaging device (Vilber ...
-
bioRxiv - Bioengineering 2022Quote: ... Membranes were blocked using Tris-buffered saline (TBS) with 1 % casein (Bio-Rad Laboratories) for 1 h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti-tubulin Rhodamine antibody (AbD22584, 1:5000, Bio-Rad Laboratories, Hercules, CA, USA) were used for immunofluorescence detection ...
-
bioRxiv - Immunology 2023Quote: ... followed by overnight incubation with F4/80 antibody (Clone CI:A3-1, Bio-Rad Laboratories) diluted in DAKO antibody diluent (1:100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... ChIP’ed DNA was eluted using an elution buffer containing 1% SDS (Bio-Rad, 1610418) and 0.1M NaHCO3 (Merck ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were loaded into a 1% certified low melt agarose gel (Bio-Rad, 1613112) in 0.5× TAE buffer with ladders (CHEF DNA Size Marker ...
-
bioRxiv - Synthetic Biology 2023Quote: ... both containing 0.1 % SDS and made from acrylamide / Bis-acrylamide solution (37.5:1, Biorad) according to established methods (69) ...
-
bioRxiv - Biochemistry 2023Quote: ... and activated for 1 min using the ChemiDoc MP Imaging system (Bio-Rad Laboratories). Activated protein was transferred to a PVDF membrane (ED Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... run in 1× TAE buffer and visualized with the ChemiDoc UV transilluminator (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... 2× ddPCR supermix for probes (no dUTP) final concentration 1× (Bio-Rad Laboratories, USA), a 20× target primer/FAM-labeled probe mix ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibody used was goat anti-rabbit-HRP (1:5000, Bio-Rad, 170-6515). Ponceau-S red staining was used for mESCs samples as a loading control.
-
bioRxiv - Microbiology 2023Quote: ... or goat anti-rabbit coupled with StarBright Blue 700 (Bio-rad, dilution 1:5000) and washed with PBST solution ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 1 hour at room temperature and imaged by the ChemiDoc Imaging System (Biorad). Images were analyzed and processed using Image Lab and quantitation of band intensity was done through Image J.
-
bioRxiv - Genetics 2023Quote: ... Quantification of protein levels normalized to β-tubulin (12004165, Bio-Rad, 1:4000 dilution) was performed using Image J software.
-
bioRxiv - Developmental Biology 2024Quote: ... a ddPCR reaction mix containing 1× ddPCR Supermix for Probes (186-3023, Bio-Rad), 250 nM of probe ...