Labshake search
Citations for Bio-Rad :
651 - 700 of 1875 citations for 2 Trimethylsilyl Furo 3 2 B Pyridine 6 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... heated to 50°C for 2 min before addition of 40 µl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 ug RNA was used to synthesize cDNA with the iScript™ cDNA Synthesis Kit (Bio-Rad 1708890). The SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad 1725271 ...
-
bioRxiv - Physiology 2023Quote: ... and samples of four larvae each were homogenized in 100 μl 2× SDS sample buffer (Bio-Rad #1610737) containing 5% (355 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... Three hundred micrograms of protein was precipitated using a ReadyPrep 2-D Cleanup Kit (Bio-Rad Laboratories, USA) at −20 °C overnight ...
-
bioRxiv - Immunology 2023Quote: ... unreacted ITC-DTPA was removed by dialysis against 0.25 M ammonium acetate (NH4Ac) pH 5.4–5.5 (metal free) supplemented with 2 g/L Chelex (Bio-Rad) using 20,000 molecular weight cut-off dialysis cassettes (Slide-a-Lyzer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of total RNA was used for cDNA preparation using the iScript cDNA Synthesis Kit (Bio-Rad). A 1/10 dilution of the cDNA was then used for qRT-PCR analysis utilizing the SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was transferred to an ice-cold 2 mm gap electroporation cuvette (Bio-Rad Laboratories GmbH, Germany), and cells were electroporated with a single pulse at 1.8 kV ...
-
bioRxiv - Genomics 2023Quote: ... Gene panel probe hybridization occurred overnight for 18 hours at 50°C (Bio-Rad DNA Engine Tetrad 2). Subsequent washes the next day removed unbound probes ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were added with equal volume of 2× Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA, USA) containing 65.8 mM Tris-HCl ...
-
bioRxiv - Genomics 2023Quote: ... proteins were transferred (80 V; 2 h; 4°C) onto a 0.2 µm nitrocellulose membrane (Bio-Rad 1620112). Membranes were air-dried ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was passed twice on 2 x Mini CHT ™ type I column (Bio-Rad, United States). Elution was performed with a gradient of 0 to 200 mM NaPO42- in 10 min ...
-
bioRxiv - Plant Biology 2022Quote: ... For α-ACTIN-2 the secondary antibody Goat Anti-Mouse IgG (H + L)-HRP conjugate (1706516, Bio-rad) was used at a dilution of 1:5000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Captured proteins were separated from beads by incubating beads in 50 μl 2× Laemmli Sample Buffer (Bio-Rad) at 95°C for 25 min ...
-
bioRxiv - Biochemistry 2023Quote: ... The detergent was removed by three 2-hour incubations with ∼33 mg of Bio-Beads SM2 (Bio-Rad) followed by overnight incubation with ∼50 mg of Bio-Beads SM2 with all incubations occurring at 4°C.
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was synthesized from total RNA (1-2 μg) with iScript Advanced cDNA Synthesis Kit (Bio-Rad; 1725038). Quantitative RT-PCR (qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA synthesis was performed using 2 μg of total RNA and the iScript cRNA synthesis kit (Bio-Rad). qPCR was performed using the Brilliant III ultra-Fast SYBR green qPCR master mix (Agilent Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... at 45 V for 2 h using the Mini-PROTEAN Tetra Vertical Electrophoresis Cell System (Bio-Rad, 1658029FC) and the blotting buffer containing 0.1 M glycine (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: Thirty micrograms of protein were denatured in 2× Laemmli sample buffer (Cat. No. 1610737, Bio-Rad, Hercules, CA) containing 4% β-mercaptoethanol at 100 °C for 5 min before loading into 4-20% SDS-polyacrylamide gels ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µL of each reaction was mixed with 10 µL of 1x Laemmli sample buffer (Bio-Rad) supplemented with 2-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of cDNA was used per qPCR reaction with iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) and 300 nM of each sense and antisense primer (20 µL total reaction volume) ...
-
bioRxiv - Biophysics 2024Quote: ... The hC1q sample was mixed at a 1:2 ratio with 2x Laemeli Sample Buffer from Bio-Rad. For the reducing conditions the Laemeli sample buffer also contained 2-β-mercaptoethanol ...
-
bioRxiv - Biochemistry 2024Quote: ... detergent was removed by addition of 0.8 grams ml-1 reaction buffer of Bio-Beads SM-2 (Biorad) prewashed in storage buffer and incubation on a roller for 2 hours at room temperature (RT) ...
-
bioRxiv - Microbiology 2020Quote: ... influenza type b serogroup-specific antisera (Bio-Rad., Pastorex™ Meningitis). Streptococcus pneumonia (S ...
-
bioRxiv - Bioengineering 2020Quote: ... After sealing with a Microseal® B Adhesive sealer (Bio-Rad), the 96-well microplate was incubated at 37 °C for 1h and the end-point image was taken by ChemiDoc™ MP Imaging System (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Plates were sealed using Microseal B adhesive sealers (BioRad MSB-1001). The following day ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cell Biology 2020Quote: ... were harvested and resuspended in 1X PBS-NaN3 (0.2%) and embedded in 2% low-melt agarose (Mb grade, BioRad). Agarose plugs were chilled at 4°C for 30 min and then ejected into Proteinase K digestion buffer (1 mg/mL proteinase K ...
-
bioRxiv - Biophysics 2022Quote: ... Nanodisc reconstitution was induced by removing detergent with 0.8 mg ml-1 pre-washed Biobeads SM-2 (Bio-Rad) for 2 hours with gentle agitation at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated in 2-mm cuvettes (600 V, 50 μF, 200 Ω) by using Gene Pulser Xcell (Biorad). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... resolved by size on a 2% agarose gel and imaged on Gel Doc XR+ and ChemiDoc XRS+ systems (Biorad).
-
bioRxiv - Cell Biology 2022Quote: ... The reaction mixture (total volume 22 μl) contained 11 μl of 2× ddPCR Super Mix for Probes (BioRad, 1863024), 1.1 μl of 4 primers mixture 18 μM each ...
-
bioRxiv - Genetics 2020Quote: ... 2 mM ATP and 1 mM DTT and the reactions were stopped by addition of Laemli sample buffer (BioRad). Samples were run on precast 4-20% gradient SDS-PAGE gels (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed in 20 μL reactions in triplicate containing 10 μL 2 × SsoFast EvaGreen Supermix (Bio-Rad,), 1 μL of primers (3 μM F and 3 μM R) ...
-
bioRxiv - Microbiology 2021Quote: ... the plates were sealed and incubated at 37°C for 2 h in a T100 Thermal Cycler (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: Resuspended purified beta-propiolactone treated SARS-CoV-2 virus preps were separated by SDS-PAGE (Bio-Rad TGX Mini) and transferred to 0.2 µM PVDF membrane according to the manufacturer’s protocols (Bio-Rad Tansblot Turbo) ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysates from SARS-CoV-2 infected Vero E6 cells were harvested in 2x Laemmli sample buffer (Bio-Rad) containing 2-Mercaptoethanol (Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 150 mM KCl and 2 mM MgCl2) at 37°C for 16 hours in thermal cycler (Bio-Rad, USA). The samples were separated using 10% non-denaturing polyacrylamide gel and tris/boric acid/EDTA buffer (TBE ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were run on 2% agarose gel and visualized in a Gel Doc EZ System (Bio-Rad, USA). GAPDH served as an endogenous control.
-
bioRxiv - Biochemistry 2021Quote: ... The protein was incubated at 4°C for 1 h with Bio-Beads™ SM-2 resin (Bio-Rad) equilibrated with 100 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... and 30μg of total protein per sample was mixed with Laemmli buffer supplemented with 2-mercaptoethanol (10%) (Bio-rad) and boiled at 99°C for 10 minutes ...
-
bioRxiv - Immunology 2022Quote: ... culture supernatants were collected and cells were directly lysed with 150 μl of 2× laemmli buffer (Bio-rad, 1610737). Proteins in culture supernatants and cell lysates were separated by SDS-PAGE and transferred onto PVDF membranes by using the Trans-Blot Turbo system (Bio-rad) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 µL of ∼500 nM RNA was mixed with 2 µL of RNA loading dye and loaded into a 1.0 cm well PAGE casting plate (BioRad). Urea-PAGE (11.2% ...
-
bioRxiv - Cell Biology 2020Quote: ... differentiated organoids and differentiated monolayers) and was calculated using the 2-ΔΔCt method using CFX Maestro software (Bio-Rad). Transcription was normalised to the expression levels of the housekeeping gene (18S ribosomal RNA ...
-
bioRxiv - Plant Biology 2020Quote: ... Each qRT-PCR reaction of CZ and ZC was performed by the manufacturer’s instructions of EvaGreen Express 2×qPCR MasterMix (abm, Cat. No.MasterMix-ES, http://www.abmGood.com/) and BioRad®CFX96 Real-Time PCR system (Bio-Rad). Relative expression was quantified with the geometric mean of internal reference genes ETIFI (eukaryotic translation initiationfactor 1) ...
-
bioRxiv - Microbiology 2020Quote: SARS-CoV-2 detection was performed on the CFX96™ Real-Time PCR Detection System (Bio-Rad, California, USA), using the NeoPlex™ COVID-19 Detection Kit (Genematrix ...
-
bioRxiv - Cancer Biology 2021Quote: ... according to the manufacturer’s instructions in a MyiQ™2 Two-Color Real-Time PCR Detection System (Bio-Rad). The threshold for detection of fluorescence was manually adjusted to 40 Relative Fluorescent Units to obtain the same threshold for each plate ...
-
bioRxiv - Cell Biology 2020Quote: ... Total numbers of viable cells were determined after 2 and 4 days using the TC10 cell counter (Bio-Rad).