Labshake search
Citations for Bio-Rad :
6251 - 6300 of 7483 citations for Mouse Claudin 1 CLDN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Messenger RNA expression was assessed with 150 to 500 ng of total RNA using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, USA, #1708891) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... SYBR qPCR Master Mix kit (Q711, Vazyme, Nanjing, China) and a Bio-Rad CFX96 real-time PCR detection system (Bio-Rad, Hercules, USA) were used for qRT-PCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... cDNA synthesis was performed for 57 samples using 500 ng of RNA per sample and the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc.). qPCR primers for the abovementioned genes were designed as described in Ahi & Sefc ...
-
bioRxiv - Immunology 2023Quote: ... Cytokine levels in cell culture supernatants was determined using the Magnetic Luminex Performance Assay (Human Base Kit A; R&D Systems, coupled with the Bio-Plex 200 (Bio-Rad). The trimmed median value was used to derive the standard curve and calculate sample concentrations.
-
bioRxiv - Immunology 2023Quote: ... The supernatant was transferred to a new microcentrifuge tube and protein concentration was determined by using a DC protein assay kit (BioRad, Cat# 500-0116). Cell lysates (500-1000 μg ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed the reverse transcription (RT) reaction with 200 ng/µl of total RNA with the iScript gDNA clear advanced kit (Bio-Rad 172-5035) and the real time qPCR was performed with the Sso Advanced SYBR Green® Supermix (Bio-Rad 172-5270 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5 U/mL aprotinin) and the protein concentrations in the lysates were determined using a BioRad protein assay kit (BioRad Laboratories, Hercules, CA). Protein samples were subjected to SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... The fungal burden of each fungus ball was determined by measuring the galactomannan (GM) content in the supernatant [43] using the Platelia Aspergillus enzyme immunoassay kit (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2023Quote: ... Japan) and quantitative PCR using a KOD SYBR qPCR kit (TOYOBO) with CFX96 Real-Time PCR System (Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... and RNA was isolated by column purification (ZymoResearch R2050) and cDNA was synthesized using the iScript Reverse Transcriptase kit (Bio-Rad, Hercules, CA). qPCR was performed using SYBR green PCR master mix (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: Reverse transcription for qPCR was either performed using gene-specific reverse priming with the iScript™ Select cDNA Synthesis Kit (Bio-Rad #1708897) or using NEB LunaScript RT SuperMix kit (NEB #E3010L) ...
-
bioRxiv - Pathology 2024Quote: ... Quantitative PCR was performed to quantify Lrp2 mRNA abundance in the kidney using SsoFast™ EvaGreen® Supermix kits (Cat # 172-5204; Bio-Rad) on a Bio-Rad CFX96 cycler ...
-
bioRxiv - Microbiology 2024Quote: ... followed by real-time RT-PCR targeting highly conserved regions of the IAV matrix (M) (10) using iTaq Universal Probes One-Step Kit (Bio-Rad, 1725141, USA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Cytokine secretion was analyzed from cleared PDEC culture supernatants using Bio-Plex Pro Human Cytokine 27-plex assay kit (Bio-Rad, cat. M500KCAF0Y) and Bio-Plex 200 System (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... The anti-HBs concentrations of the DBS samples were then tested using the Monolisa Anti-HBs PLUS kit (Bio-Rad, Hercules, CA, USA) with a 2.00 mIU/mL lower limit of detection (LoD ...
-
bioRxiv - Cell Biology 2020Quote: ... X-ray film (Figs 1-5) and the ChemiDoc MP Imaging System (Bio-Rad, cat#17001402) (Supplemental Fig 3).
-
bioRxiv - Microbiology 2021Quote: ... Digested DNA fragments were then subjected to 1% agarose pulsed-field gel electrophoresis (PFGE) (Bio-Rad) using 0.5% Tris/Borate/EDTA (TBE ...
-
bioRxiv - Biochemistry 2022Quote: ... was added for 1 hour and membranes were imaged using Clarity Western ECL Substrate (Biorad, 1705061).
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA (1 µg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Bioengineering 2022Quote: ... or rat anti-F4/80 (rat anti-F4/80 antibody, 1:50, BioRad, MCA497GA, Hercules, CA). Cells were again washed in DPBS and incubated for 1 h at room temperature with Alexa Fluor® 488-conjugated secondary antibody (goat polyclonal antibody to rabbit IgG ...
-
bioRxiv - Immunology 2021Quote: ... with specific primers as listed in Table 1 and iTaq Universal SYBR Supermix (Bio-Rad, USA). The 10 µL reaction consisted of 5.0 µL 2X Supermix ...
-
bioRxiv - Cell Biology 2019Quote: ... 0.1% Tween 20 (TBST) followed by 1hr incubation with secondary antibody in TBST (1:5000, Biorad). Three washes were given for 10 minutes each after the secondary antibody incubation ...
-
bioRxiv - Bioengineering 2019Quote: ... according to the manufacturer’s manual using a 1% certified megabase agarose (Bio-Rad Laboratories, Cat. # 1613108) gel in 0.5x Tris-borate-EDTA buffer (TBE) ...
-
bioRxiv - Neuroscience 2019Quote: ... three sections of tissue were stained with antibodies against proteolipid protein (MCA839G; Bio-Rad; 1:1000) and imaged at a spatial resolution of 0.28 µm/pixel ...
-
bioRxiv - Developmental Biology 2020Quote: ... We ran the qPCR reactions using 1-2 µl cDNA in SYBR Green Master Mix (Biorad) totaling 20 µl in a Biorad CFX96 machine using 60°C as the annealing temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... Lysate aliquots with 16 µg protein were denatured in 1× Laemmli sample buffer (Bio-Rad, 1610747) for 5 min at 95°C ...
-
bioRxiv - Microbiology 2019Quote: ... Protein was applied at 1 ml/min to a 5 ml ceramic hydroxyapatite column (BioRad BioscaleTM) in the dialysis buffer ...
-
bioRxiv - Microbiology 2019Quote: ... The bead/lysate mixture was allowed to pack in a 1 cm separation column (Bio-Rad) and washed with Wash Buffer (50 mM Na2HPO4 ...
-
bioRxiv - Genetics 2020Quote: ... in 11 parallel transformations (1 mL each) on a Bio-Rad MicroPulser (Bio-Rad, #165-2100). The parallel transformations were combined and mixed with a total of 9.5 mL of recovery medium ...
-
bioRxiv - Biochemistry 2020Quote: ... The absorbance readings were collected at 260nm with a Econo UV Monitor (EM-1 220V, Biorad). After fractionation ...
-
bioRxiv - Neuroscience 2021Quote: ... or Goat Anti-Rabbit IgG (H L)-HRP Conjugate (1:1000; Bio-Rad; Catalog # 172-1019) in TBS-T for 1 hr at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7) for 30 min to 1 hr then assembled in a dot blot apparatus (BioRad). After washing with 100 μl TE buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Biochemistry 2021Quote: ... the detergent was removed by adding 0.5 g mL-1 (w/v) Bio-Beads (Bio-Rad) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The assay medium was prepared by diluting 1 volume of alamarBlue dye reagent (BUF012A; Bio-Rad) in 9 volumes of growth medium ...
-
bioRxiv - Microbiology 2020Quote: ... loaded onto a lab-made 8% TBE gel (Acrylamide/Bis solution 37.5:1, Bio-rad, 1610148), run at 200V for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... The following secondary antibodies were used: goat anti-rabbit HRP (1:5000, Bio-Rad: 170-5046) and goat anti-mouse HRP (1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... coli strain S17-1 using a Gene Pulser Xcell™ (Bio-Rad, Hercules, CA, United States) with the conditions of 2.5kV ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA (1 μg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-conjugated Goat Anti-Rabbit IgG (H+L) (1:1000, 170-6515, Bio-Rad, CA, USA) or Goat-anti-Mouse IgG (1:1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... qPCRs were then performed with 1 μl of cDNA using Universal SYBR green Supermix (BIO-RAD). Primer sets used for real-time PCR analysis are qcopA forward (CAATACCCTGGTGGTCGATAAAAC ...
-
bioRxiv - Biochemistry 2022Quote: ... at 1:3000 dilution and with the ladder conjugate (Precision Protein StrepTactin-HRP Conjugate, Bio-Rad) at 1:5000 dilution ...
-
bioRxiv - Genetics 2022Quote: ... The membranes were blocked with 1x Tris buffered saline with 1% casein (Bio-Rad, Cat #: 1610782) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Boiled samples were diluted 1:1000 and subsequently used as templates for IQ SYBR (Bio-Rad) qPCR reactions ...
-
bioRxiv - Genomics 2022Quote: 1 µg of total RNA was reverse transcribed using iScript reverse transcription supermix (Biorad, Solna, Sweden). RT-qPCR was performed using a LightCycler 96 and the SYBR green master mix (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA (1 µg) was reverse-transcribed using the iScript™ Reverse Transcription Supermix (Bio-Rad) as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: ... Electroporation was performed using a cuvette with a width of 1 mm and an electroporator (Biorad) with the settings ...
-
bioRxiv - Biophysics 2020Quote: ... Nanodisc reconstitution was achieved by incubation with 0.5 - 1 mL Bio-Beads SM-2 (Bio-Rad) for 16 hours at 4°C under constant rotation ...