Labshake search
Citations for Bio-Rad :
501 - 550 of 1458 citations for 2 CHLOROMETHYL 6 METHOXY 1H BENZO D IMIDAZOLE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 2 x iTaq Universal SYBR Green Supermix (Bio-Rad, 1725125) was used for the Reverse Transcription-Polymerase Chain Reaction (RT-PCR ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 μl 2 x EVA-Green master mix (Bio-Rad), 1 μl HindIII-HF (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Microbiology 2023Quote: ... Detergent was removed using adsorbing SM-2 Biobeads (Bio-Rad): the protein-lipid mix was incubated twice with fresh Biobeads at 10:1 (w:w ...
-
bioRxiv - Microbiology 2023Quote: ... and β-tubulin (clone YL1/2, Bio-Rad; 1:5000) antibodies at 4°C overnight ...
-
bioRxiv - Microbiology 2022Quote: ... Extracts were diluted with 2□×□Laemmli sample buffer (Bio-Rad) and β-mercaptoethanol (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... including 7.5 μl of 2× iQSYBR Green Mix (Bio-Rad) and 100–300 nM forward and reverse primers ...
-
bioRxiv - Neuroscience 2023Quote: ... 60 mg of Bio-Beads SM-2 (#1523920, Bio-Rad) was added ...
-
bioRxiv - Systems Biology 2024Quote: ... buffer + 2% (v/v) Sodium dodecyl sulfate (SDS, Bio-Rad). Proteins were denatured at 95 °C and 600 rpm for 10 min before adding a final concentration of 2% (v/v ...
-
bioRxiv - Genomics 2022Quote: ... The lysate was added to 2 chromatography columns (7321010, BioRad) packed with 25 mL each of chitin resin (S6651S ...
-
bioRxiv - Microbiology 2022Quote: ... Capacitors were 1-cm Tygon tubing (2 mm ID, BioRad), having Luer connectors on each extremity ...
-
bioRxiv - Microbiology 2022Quote: ... Extracts were diluted with 2 × Laemmli sample buffer (Bio-Rad) and β-mercaptoethanol (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... We placed 2 g/L Chelex 100 resin (Bio-Rad) in the dialysis buffer to chelate divalent metal ions ...
-
bioRxiv - Immunology 2024Quote: ... and 2 % bis-acrylamide solutions (594 µL, #1610142, Bio-rad) were formulated in distilled water (2736 µL ...
-
bioRxiv - Biophysics 2024Quote: ... then detergent was removed with BioBeads SM-2 (Bio-Rad) at 80 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... 4X Laemmli Sample Buffer containing 10% 2-Mercaptoethanol (Bio-Rad) was added to each sample to a final concentration of 1X ...
-
bioRxiv - Bioengineering 2024Quote: ... and 30 % v/v bis-acrylamide 2 % (Bio-rad: 1610142) were added to produce the gels and mixed with 2 % v/v fluorescent carboxylated 200 nm beads (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... and 8 % v/v bis-acrylamide 2 % (Bio-rad: 1610142) were added to produce the gels and mixed with 2 % v/v fluorescent carboxylated 200 nm beads (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... Visualisation and quantification were carried out using a Personal Molecular Imager with Quantity One 1-D analysis software (Bio-Rad) and data were analyzed with GraphPad Prism 4 software.
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... 40S and 80S fractions were quantified using Quantity One 1-D Analysis Software v.4.1.2 (Bio-Rad Laboratories, Hercules, CA). Pno1 was quantified using ImageJ Software v1.52 (100 ...
-
bioRxiv - Biochemistry 2021Quote: ... Melting temperature was determined from the region of maximal slope as visualized by the first derivative of fluorescence with respect to temperature (minimal-d(RFU)/dT) per default behavior of Bio-Rad CFX manager software (BioRad).
-
bioRxiv - Biochemistry 2023Quote: ... 2mM DTT and 0.02% n-dodecyl-β-D-maltopyranoside [DDM]) buffer after transferring into Econo columns (Biorad, Cat. no. 7372512). Thrombin at concentration 1unit µL-1 was added to the resin slurry at 1:1 (dry resin:cleavage buffer ...
-
bioRxiv - Immunology 2024Quote: ... and RANTES/CCL5 (R&D Biotechne) according to the manufacturer’s protocol and analyzed using the Bio-Plex 200 platform (Bio-rad). Analyte concentrations were calculated using a standard curve (5 PL regression ...
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (15 μg) were loaded on 4-15% 1 D polyacrylamide Mini-PROTEAN TGX Stain-Free gels (BioRad) and run in 1X Tris Glycine SDS buffer (BioRad ...
-
bioRxiv - Biophysics 2024Quote: Claudins purified as described above were exchanged from DDM to 2,2-didecylpropane-1,3-bis-β-D-maltopyranoside (LMNG) detergent via a PD-10 column (Bio-Rad). COP-1 was added in 1.4 moles excess to claudins then 1.4 moles excess Nb to COP-1 were mixed and incubated at 4°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... The deamination reaction was then carried out by incubating in a thermal cycler for four cycles of 5 minutes at 70°C followed by 1 hour at 60°C and then desalted with Micro Bio-spin 6 chromatography columns (Bio-Rad). RNA was desulphonated by adding an equal volume of 1 M Tris (pH 9.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... IB analysis was performed after 6-7.5% SDS-PAGE or 4-20% Mini-PROTEAN TGX Precast Protein Gels (BioRad, Hercules, CA), with overnight incubation with a 1:1000 dilution of primary antibody and followed by a 1:5000 dilution of horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody (Jackson ImmunoResearch ...
-
bioRxiv - Bioengineering 2020Quote: ... Equal volumes of 10 mg/L (GT)15- or (GT)6-Cy5-SWCNTs and 160 mg/L protein were added to a 96-well PCR plate (Bio-Rad) to a total volume of 50 μL ...
-
bioRxiv - Biophysics 2021Quote: ... beads were washed with wash buffer 6-8 times in poly-prep chromatography columns (cat. no. 7311550, BIO-RAD laboratories Inc). Protein was eluted using Ni-NTA elution buffer (50□mM NaPi pH 7.6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples (20 µg/lane) were electrophoresed on a 6–12% SDS polyacrylamide gel in a Mini-PROTEAN Tetra Cell (Bio-Rad) and subsequently transferred to a nitrocellulose membrane (Sartorius AG ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously described 58 and a custom Bio-Rad 6-plex based on the Human Inflammation Panel 1 (BioRad, Cat# 171AL001M). For both assays ...
-
bioRxiv - Cell Biology 2021Quote: ... inside an anaerobic glove-box and the excess DTT was completely removed via a Bio-Gel P-6 DG gel-desalting column (Bio-Rad) in thoroughly de-oxygenated MOPS buffer (20 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... and purified by vertical gel electrophoresis on a 6% (60:1 Acrylamide/Bisacrylamide) native gel column using a 491 Prep Cell (Bio-rad) run at 10W and 4°C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... were then generated using the piggyBac transposon system as described.12 Protein expression was induced with doxycycline and secreted fusion protein was separated from expression media using IgG Sepharose 6 Fast Flow resin (GE-Healthcare) in a 10 mL Poly-Prep chromatography column (Bio-Rad). Resin was washed with 50 column volumes of wash buffer (10 mM Tris pH 7.5 ...
-
bioRxiv - Immunology 2020Quote: ... The concentrations of mouse and human IL-6 and TNF-α were determined by a multiplex Bio-Plex assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were dried out at RT and then exposed to a phosphoscreen cassette (GE) for 6 days for further scanning in a phosphoimager analyzer (Bio-Rad).
-
bioRxiv - Genetics 2020Quote: ... chromosomal DNA plugs were prepared and separated on 1% agarose gel at 6 V/cm for 48 hrs (initial time = 20s, final time = 30s) by using the CHEF DRII apparatus (Bio-Rad), followed by Southern blotting and hybridization with a TRP1 sequence as a probe.
-
bioRxiv - Biochemistry 2023Quote: ... The 6× His-tag blots were washed with TMST and TSM and developed with the Clarity Western ECL kit (Bio-Rad) and imaged in a Gel-Doc system (Bio-Rad) ...
-
bioRxiv - Immunology 2024Quote: ... The gel was imaged under the Silver Stain setting on Image Lab 6 on a Gel Doc EZ Imager (Bio-Rad). ImageJ was used to quantify band intensities and determine peptide loading efficiencies.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown at 30°C for 3-6 days and images captured using a Chemidoc XRS+ imager (BioRad, Hercules, CA). All images were evenly adjusted in Photoshop (Adobe Systems Incorporated ...
-
β-catenin programs a tissue-specific epigenetic vulnerability in aggressive adrenocortical carcinomabioRxiv - Cancer Biology 2022Quote: Samples were prepared by boiling at 95°C for 6 minutes in lysis buffer supplemented with 4x Laemmli Sample Buffer (Bio-Rad), with 355 mM 2-mercaptoethanol freshly added according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... or immunoprecipitated samples were resolved by SDS-PAGE (6% to 10%) and transferred onto methanol-treated immun-blot PVDF membrane (Bio-Rad). The membranes were incubated overnight at 4°C with corresponding primary antibodies (antibody information ...
-
bioRxiv - Physiology 2023Quote: ... The incorporated radioactive methionine and cysteine signal was detected using Typhoon Imager (GE) and quantified using Image Lab 6 software (Bio-Rad). Afterwards ...
-
bioRxiv - Cell Biology 2023Quote: Samples were diluted in 5x loading buffer and ∼30 mg run out on a 6-14% SDS-PAGE gel as described before semi-dry Western blotting (BioRad TurboID). Ponceau stained images were taken ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each sample was separated by non-reducing SDS-PAGE (6% acrylamide gel) with Precision Plus Protein Dual Color Standards (Bio-Rad) and transferred to nitrocellulose membrane overnight at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... PBMCs isolated from two donors were infected with GFP-EBV for 28 days in 6-well plates and subsequent B-cells blasts were photographed using using a ZOE Fluorescent Cell Imager (BIO-RAD). Using similar strategy ...