Labshake search
Citations for Bio-Rad :
501 - 550 of 4573 citations for 14 Nonylphenoxy 3 6 9 12 tetraoxatetradecan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Samples were separated in 12 % Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad, München, Germany) and transferred onto polyvinylidene fluoride (PVDF ...
-
bioRxiv - Immunology 2022Quote: ... Following antibodies were used for cell surface staining: anti-CD3 (Bio-Rad, #MCA1477PB, CD3-12), anti-CD4 (BioLegend ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells extracts were resolved on 12% SDS-PAGE and transferred to nitrocellulose membrane (Bio-Rad). Immunoblot analysis was performed by overnight incubation with antibodies against BiP ...
-
bioRxiv - Plant Biology 2023Quote: ... Samples were separated on 12% SDS-PAGE gels (Mini-Protean TGX Stain-Free Precast, BioRad) and GST-TEV-PROPEP1 protein bands were visualized on a BioRad Imager (stain-free) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 μg of total protein was separated on a 4-12% polyacrylamide gel (BioRad #3450124) in MOPS Running Buffer (BioRad #1610788 ...
-
bioRxiv - Biochemistry 2022Quote: ... before loading on a denaturing non-reducing 12% criterion XT Bis-Tris gel (Bio-Rad).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... subjected to SDS-PAGE in 12% TGX stain free gel (Bio-Rad, Hercules, CA, USA), and transferred to nitrocellulose membrane by semi-dry protein transfer (TransBlot Turbo ...
-
bioRxiv - Genetics 2024Quote: Protein samples were loaded onto a 7.5% or 12% polyacrylamide gels (Bio-Rad Cat #3459902) and run at 150 to 200 Volts in running buffer (25 mM Tris ...
-
bioRxiv - Physiology 2024Quote: ... Proteins were separated on 4–12% gradient gels and transferred to nitrocellulose membranes (Bio-Rad), blocked (Li-COR Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... Equal amounts of protein lysates were separated on polyacrylamide 8–12% gels (BioRad, Hercules, CA) by electrophoresis and transferred to nitrocellulose membranes ...
-
bioRxiv - Plant Biology 2024Quote: ... resolved on 4-12% or 16% Mini-PROTEAN® TGX™ Precast Gels (BIO-RAD), and stained with Coomassie (ReadyBlue® protein gel stain ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein was separated on a 4–12% Criterion XT Bis-Tris protein gel (Bio-Rad) with XT MES buffer and was transferred to polyvinylidene difluoride membranes using the Trans-Blot Turbo Transfer system (Bio-Rad) ...
-
bioRxiv - Immunology 2024Quote: ... The denatured protein samples (20 µl) were loaded onto 12% precasted polyacrylamide gels (Bio-Rad). For western blot analysis ...
-
bioRxiv - Microbiology 2024Quote: ... samples were maintained at 12°C until analysis on a droplet reader (Bio-Rad, QX200). Samples were excluded if they yielded fewer than 10,000 droplets ...
-
bioRxiv - Neuroscience 2024Quote: ... using SsoAdvanced Universal SYBR Green Supermix (12 μL final mix per reaction; 1725272, Bio-Rad). In this study ...
-
bioRxiv - Cancer Biology 2024Quote: ... 30 µg of lysate was resolved on 8-12% Bis-Acrylamide gel (Bio-Rad; 1610158) and transferred to PVDF membrane (Bio-Rad ...
-
bioRxiv - Bioengineering 2024Quote: ... Each reaction contained 12 µL of 2x ddPCRSupermix for probes (No dUTP) (1863025 Bio-Rad), 1.2 µL of each primer and probe mix to final concentration of 0.5 uM for each primer and 0.25 uM for each probe ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Physiology 2022Quote: ... such that a total of 2 μg protein in 20 μL of buffer was loaded into wells of a Mini-PROTEAN TGX Stain-Free gel (5-14%) (Bio-Rad, Mississauga, ON, Canada). Protein ladder (5 μL of Precision Plus Protein™ All Blue Prestained Protein Standards ...
-
bioRxiv - Immunology 2020Quote: ... a total of 6 × 107 cells was incubated in staining buffer with mouse anti-pig CD4 alpha (clone MIL17, Bio-Rad AbD Serotec, Puchheim, Germany, 1:50) at 4°C for 20 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were rinsed 3×10 minutes in TBST 0.1% then incubated with appropriate secondary antibody coupled to the horseradish peroxidase (Biorad, 1706515, 1706516; 1/5000) for 1 hour at room temperature under agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µL primer 556R (5’ CTTTACGCCCARTRAWTCCG 3’) at 10 µM and 10 µL SYBER® Green Master Mix (Bio-Rad, Veenendaal, The Netherlands). The DNA extraction estimated an average rRNA yield corresponding to 5×10^8 bacterial cells/mL.
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... a desalting step was performed using micro Bio-Spin™ 6 (BIO-RAD) with 500mM ammonium acetate ...
-
bioRxiv - Immunology 2021Quote: ... followed by desalting using Micro Bio-spin 6 Chromatography Columns (Biorad, 732-6200). Then ...
-
bioRxiv - Immunology 2022Quote: ... using Iodogen reaction and then purified by P-6 spin column (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using primers shown in Supplementary Table 6 and IQ SYBRGreen supermix (Bio-Rad). The relative standard curve method was used to calculate arbitrary gene expression using CFX-manager software (Bio-Rad) ...
-
bioRxiv - Biochemistry 2021Quote: ... Excess MTS reagents were removed with Micro Bio-Spin 6 columns (Bio-Rad) equilibrated in crosslinking buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... The labeled antibodies are purified by P-6 Micro Bio-Spin Columns (BioRad).
-
bioRxiv - Cell Biology 2024Quote: ... PCR reactions were performed with Applied Biosystems QuantStudio 6 Flex using Sybrgreen (Biorad). Assays were performed in duplicate ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were buffer-exchanged using Micro Bio-Spin 6 desalting column (Bio-Rad) into 200mM ammonium acetate (pH adjusted to 7.4 with ammonium hydroxide) ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were purified with Micro Bio-Spin P-6 columns (Bio-Rad Laboratories) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 0.1 g of 45-90 µm polyacrylamide beads (Bio-Gel P-6, BioRad) were added to help uniformly distribute the moisture throughout the porous media ...
-
bioRxiv - Biochemistry 2024Quote: ... a buffer exchange was performed using BioSpin 6 column (BioRad, part# 732-6222) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Bioengineering 2024Quote: ... equipped with a refractive index detector following isocratic elution on a Aminex HPX-87H column (300 x 7.8 mm, 9 µm particle size; Bio-Rad Laboratories, CA, USA, cat. # 1250140) for a total run time of 20 min employing 5mM H2SO4 as mobile phase buffer ...
-
bioRxiv - Systems Biology 2020Quote: ... 50 mM DTT) and 3 mL oil (Biorad #1864006). After encapsulation ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Neuroscience 2022Quote: ... and analyzed with Opticon Monitor 3 and GeneX (BioRad) software ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed in 3% paraformaldehyde (Bio-rad) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... from a 3% low range agarose gel (BioRad, 1613107) to remove adapter dimers.
-
bioRxiv - Biophysics 2024Quote: ... 0.2% (w/v) Bio-Lyte 3/10 Ampholyte (BioRad), 1% bromophenol blue) ...