Labshake search
Citations for Bio-Rad :
751 - 800 of 4573 citations for 14 Nonylphenoxy 3 6 9 12 tetraoxatetradecan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... pH 3-10 ReadyStrip IPG Strips (Bio-Rad, Hercules, CA, USA) at 50 μA per strip at 20 °C ...
-
bioRxiv - Microbiology 2024Quote: ... and transcript quantification (QuantStudio 3, Bio-Rad Laboratories Inc., Hercules, CA) were performed as previously described (29).
-
bioRxiv - Cell Biology 2024Quote: ... in a Mini-PROTEAN®3 System (Bio-Rad, Hercules, CA). After electrophoresis ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Microbiology 2022Quote: ... and 1’,3’-bis[1-palmitoyl-2-oleoyl-sn-glycero-3-phospho]-glycerol (16:0-18:1 Cardiolipin) were spotted using a Hamilton syringe onto a nitrocellulose membrane (Biorad trans-blot turbo RTA Midi 0.2 µm) to yield 10 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and loaded in 4- 12% Mini-PROTEAN Tris-Tricine Precast Gels or Criterion Tris-Tricine Precast Gels (Bio-Rad). Anti- AGO-2 (Novus ...
-
bioRxiv - Biophysics 2020Quote: ... An amount of 12 μg of each protein sample was applied on 4-20% gradient precast gel (BioRad, USA). Gels were stained using Coomassie brilliant blue G-250 (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... Corresponding fractions for each chromatogram between 12 and 18 ml with an interval of 0.5ml were analyzed by SDS-PAGE (Biorad) and Instant blue coomassie staining (Expedeon).
-
bioRxiv - Neuroscience 2020Quote: ... Cell lysates and sEV/exosome samples (derived from 1.6×107 cells) were subjected to 12 % SDS-PAGE and Western blotting (Biorad) or to 4-12 % (Bis-Tris gel ...
-
bioRxiv - Biochemistry 2021Quote: ... 120-250 μg of crude extracts were run in a pre-cast 4-12% SDS-PAGE gradient gel (Biorad) and then electro-transferred onto a 0.2 μm nitrocellulose membrane (Biorad) ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were separated using 12% polyacrylamide gels and transferred onto a PVDF membrane using Trans-Blot Turbo (Bio-Rad). The following primary antibodies were used ...
-
bioRxiv - Plant Biology 2021Quote: ... and 30 μg of total protein was separated by 12 % SDS-PAGE and blotted onto PVDF membrane (Bio-Rad). The membranes were blocked in 5 % (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... We loaded 10 μL of each sample into a pre-prepared 12% sodium dodecyl sulfate (SDS) gel (Bio-Rad) and separated the protein by electrophoresis at 100 V for 1 h in a Bio-Rad Tetra cell apparatus ...
-
bioRxiv - Cell Biology 2021Quote: ... heated for 10 min at 95°C and loaded on Mini Protean TGX precast gel 4-12% (Bio-Rad). For the blot ...
-
bioRxiv - Cell Biology 2022Quote: ... After boiling for 5min, samples were analyzed by SDS-PAGE (4-12% Bis-Tris gel, (Bio-Rad Laboratories, Inc.) and transferred to nitrocellulose membranes (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... A 50 μg aliquot of total was separated by electrophoresis in precast 4-12% Bis-Tris Gels (Bio-Rad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Pathology 2022Quote: ... prior to incubation for 30 min/RT with the antibodies: FITC-conjugated anti-CD3e (MCA1477A647, clone CD3-12, BioRad) and PE- conjugated anti-IFNγ (MCA1783PE ...
-
bioRxiv - Immunology 2022Quote: ... 30 ug of Protein extracts were separated by 4-12% Bold NuPage (ThermoScientific) and transferred onto PVDF membranes (BioRad). After blocking with 3% albumin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Equivalent amounts of protein were subjected to electrophoresis on a 4-12% Mini-PROTEAN® TGXTM Gel (Bio-Rad) and transferred to a Hybond-ECL nitrocellulose membrane (Amersham - GE Healthcare Life Sciences) ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein samples were then separated on 12 % polyacrylamide gels (Mini-Protean II electrophoresis cell, BioRad, Marnes-la-Coquette, France) and transferred to 0.2 μm nitrocellulose blotting membrane (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... 1D SDS-PAGE were carried out on 12% gel at constant 20 mA in a Miniprotean 2D-chamber (BioRad). Supernatants obtained after depletion were mixed in a ratio of 1 ...
-
bioRxiv - Genomics 2021Quote: The proteins were separated electrophoretically using a 4–12% gradient gel and transferred to a nitrocellulose membrane (Bio-Rad, Trans-Blot® Transfer Medium ...
-
CCG•CGG interruptions in high penetrance SCA8 families increase RAN translation and protein toxicitybioRxiv - Genetics 2021Quote: ... The protein lysate concentration was quantified using Pierce BCA Protein Assay Kit (ThermoScientific) and10μg of soluble protein lysates were separated on a 4-12% Bis-Tris gel (BioRad) and transferred to a nitrocellulose membrane ...
-
bioRxiv - Genetics 2021Quote: ... 2.4 μl of cDNA was analyzed in 12 μl reactions using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) according to the manufacturer’s instructions and included each respective forward and reverse gene-specific primers (Table S12) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 35 μg of protein was resolved on 4-12% polyacrylamide gradient Criterion XT Bis-Tris Precast Gels (Biorad Laboratories) and transferred to a nitrocellulose membrane (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of protein were loaded onto 10% or 12% pre-cast Tris-HCl Mini-PROTEAN gels (Bio-Rad) and proteins separated by electrophoresis ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were separated by SDS-PAGE in 12% Bis-Tris gels and transferred onto 0.45 µm nitrocellulose membranes (BioRad). The blots were incubated overnight at 4°C with anti-αSyn (1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... Total protein lysates were separated on 12% or 4%-15% Mini-PROTEAN® TGX™ Precast Protein Gels (BioRad), transferred on a nitrocellulose membrane (BioRad ...
-
bioRxiv - Neuroscience 2021Quote: ... The digested fibrillar products were separated by SDS-PAGE using precast 12% Bis-Tris gels (Bio-Rad, Criterion XT) with MES running buffer (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... and 10-15 µg of protein was loaded into 12% acrylamide Criterion XT Bis-Tris Precast Gels (Bio-Rad). Electrophoresis was performed with NuPage MES SDS Running Buffer (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples (50µg of protein/lane) were separated on a 4-12% SDS-polyacrylamide gel (Bio-Rad, Hercules, CA, USA) and probed with anti-ACK antibody (1:100 ...
-
bioRxiv - Immunology 2022Quote: ... loaded onto a 12% acrylamide gel and separated proteins transferred onto a PVDF membrane (Bio-Rad, Hercules, California, US). Membranes were washed in 1X TBS ...