Labshake search
Citations for GeneCopoeia :
1 - 50 of 93 citations for WD Repeat Containing Planar Cell Polarity Effector WDPCP Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... The fluorescent probes were incubated for at least 10 min with 10mM biotin (GeneCopoeia) to saturate the unconjugated streptavidinfluorochrome complexes ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of A33 protein was performed by using the biotin-protein ligase kit (GeneCopoeia™, B1001) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... containing mouse CD4-eYFP (GeneCopoeia), into a pcDNA3.1 tGFP-P2A-mCherry vector ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Cell Biology 2022Quote: Stable cell lines expressing FLAG-tagged SLC25A1 were prepared by transfecting human neuroblastoma SH-SY5Y cells (ATCC, CRL-2266; RRID:CVCL_0019) with ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia, EX-A1932-Lv1020GS) (Gokhale et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... Two μg of the construct containing mS29 was transfected to the HEK293T mS29-KO cell line using 5 μL of EndoFectin™ Max (GeneCopoeia) pre-incubated in Opti-MEM (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: ... To saturate unconjugated streptavidin-fluorochrome complexes the fluorescent probes were next incubated for at least 10 min with 10mM biotin (GeneCopoeia) to saturate the unconjugated streptavidin-fluorochrome complexes ...
-
bioRxiv - Cancer Biology 2023Quote: ... lentiviral particles containing full length of either DUSP1 (Genecopoeia) or DUSP6 (Addgene #27975 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or containing the cDNA for human MGP (EX-Z9471-Lv122; GeneCopoeia), and the following packaging vectors ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: Construct containing full-length human TOP2A cDNA sequence were purchased from Genecopoeia. Site-directed mutagenesis were conducted using QuikChange Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Neuroscience 2020Quote: ... or ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia, EX-A1932-Lv1020GS). The stably transfected cell lines were selectively maintained in media containing DMEM supplemented with 10% FBS ...
-
bioRxiv - Genetics 2019Quote: ... A pDONR entry clone containing the human rhodopsin cDNA sequence was purchased (GeneCopoeia #GC-T1321, Rockville, MD). Each of the 210 RHO variants was created via site-directed mutagenesis using a one-primer modification to the QuikChange II protocol from Agilent.((Braman ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...
-
bioRxiv - Immunology 2024Quote: ... as well as a TSHR vector containing GFP and a puromycin resistance gene (Genecopoeia Inc., Rockville, MD, USA). These cells were then cultured in selection media containing either hygromycin (1 µg/mL ...
-
bioRxiv - Cancer Biology 2019Quote: Luciferase reporter plasmids containing the Wee1 mRNA3’-UTR (HmiT054534-MT06) or the Chk1 mRNA3’-UTR (HmiT061994-MT06) were purchased from GeneCopoeia. Twenty four hours before transfection ...
-
bioRxiv - Cell Biology 2022Quote: The expression construct for full-length human CEMIP (Uniprot ID: Q8WUJ3) containing a FLAG tag at the C-terminus in pReceiver-M39 was purchased from GeneCopoeia. HEK293 expressing the SV40 large T antigen were cultured in DMEM/F12 with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with the firefly luciferase-expressing (pEZX-MT05) plasmids containing the 3′UTR of BIM or an empty vector (Genecopoeia) and were co-transfected with miR-24-3p mimic ...
-
bioRxiv - Neuroscience 2020Quote: ... REST overexpression was performed by transducing DRG neurons with lentiviral constructs containing either REST (Lv135-REST) or humanized luciferase protein (Lv135-hLuc) as a control driven by the CMV promoter (GeneCopoeia). DRG neurons were replated 7 days after the viral infection ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and SIRT1 KO E14 mESCs were generated by CRISPR/Cas9 mediated gene editing technology using lentivirus carrying either all-in-one empty vector pCRISPR-CG01 vector or pCRISPR-CG01 containing different sgRNAs targeting mouse Sirt1 gene (GeneCopoeia). Stable single colonies were picked up and screened with immunoblotting assay using anti-SIRT1 antibodies ...
-
bioRxiv - Bioengineering 2022Quote: ... HEK293Ta cells (Genecopoeia) were transfected with the purified genes using calcium phosphate nanoparticles ...
-
bioRxiv - Cell Biology 2022Quote: ... The viral vector was based on a commercially-available pEZX-LvPM02 lentiviral construct containing the myogenin promoter (MPRM15676-LvPM02, Genecopoeia, Rockville, MD). The plasmid map can be found in Supplementary Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Bioengineering 2022Quote: HEK293Ta cells were purchased from GeneCopoeia and maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Immunology 2021Quote: ... and Lenti-Pac 293Ta cells (GeneCopoeia)(24) ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Cell Biology 2019Quote: ... Pseudolentiviral particles were made in HEK-293Ta cells (GeneCopoeia) by co-transfection of psPAX2 ...
-
bioRxiv - Genomics 2019Quote: ... cell culture media was refreshed and TiterBoost reagent (GeneCopoeia) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transduced with lentiviral particles (GeneCopoeia, Rockville, MD) overnight then selected and maintained in HAM’s F10 (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... A549 cell line stably expressing CRISPR Cas9 nuclease (Genecopoeia) was used to generate CEACAM6 knock-out cells (A549-CEACAM6-KO ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with 0.5 μg POM121-GFP plasmid (Genecopoeia) using Nanojuice transfection reagent ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1 mL of MitoBeacon Red (GeneCopoeia, U.S.A.) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... PFN1 KO cells were generated with the pCRISPR-CG02 vector (Genecopoeia) containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia ...
-
bioRxiv - Immunology 2024Quote: ... MDA-MB-231 cell line was obtained from GeneCopoeia (Cat# SL018). THP-1 cells were cultured in RPMI-1640 medium containing 10% (vol/vol ...
-
bioRxiv - Immunology 2022Quote: ... All cell lines underwent routine mycoplasma testing with MycoGuard (Genecopoeia #LT07-118). The following drugs and chemicals were used as part of this study ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells were co-transfected with Nup358 CRISPR-Cas9 (pCRISPR-CG01, GeneCopoeia) and pTSiN-puro-Cre constructs ...
-
bioRxiv - Cancer Biology 2021Quote: LNCaP cells were transfected with a Trib2 promoter-luciferase construct (5.6kb; Genecopoeia) using Lipofectamine 3000 transfection reagent (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... All cell lines underwent routine mycoplasma testing with MycoGuard (Genecopoeia #LT07-118).
-
bioRxiv - Cancer Biology 2021Quote: ... Control cells were generated by transducing a scrambled control (Genecopoeia #CMIR-AN0001-AM039).
-
bioRxiv - Bioengineering 2023Quote: ... HEK 293T cells expressing ACE2 and TMPRSS2 were purchased from Genecopoeia (Catalog # SL222). The pseudovirus particles used in the study were procured from eEnzyme (catalog #s SCV2-PsV-Omicron ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were transfected with 10 μg of Flag-tagged HsFN3K (EX-W1392-M46, GeneCopoeia) using Calcium Phosphate Transfection protocol (43) ...
-
bioRxiv - Immunology 2023Quote: ... Cell lysates were analyzed with Luc-Pair Duo-Luciferase assay kit (GeneCopoeia; cat # LF003) using a VICTOR Nivo multimode microplate reader (PerkinElmer ...
-
bioRxiv - Neuroscience 2020Quote: ... SH-SY5Y cells were transfected either with a control empty vector (GeneCopoeia, EX-NEG-Lv102) or ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2022Quote: ... Suit2 cells were transduced with ST6GAL1-expressing lentivirus (Genecopoeia, cat#LPP-M0351-Lv105-200-5) or empty vector lentivirus (Sigma) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The JeKo-1 cell line expressing luciferase was generated using HLUC-Lv105 lentiviral particles (GeneCopoeia) and selected with puromycin ...
-
bioRxiv - Synthetic Biology 2023Quote: Human embryonic kidney 293Ta (HEK293Ta) and HEK293T Lenti-X cells were purchased from GeneCopoeia (#LT008) and Takara (#632180) ...
-
bioRxiv - Cancer Biology 2023Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Bioengineering 2020Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD, USA). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Cancer Biology 2020Quote: ... we transfected the cells with control vector or pReceiver-M39 vector expressing FXR1 (GeneCopoeia, Rockville, MD) using Lipofectamine 2000 (Invitrogen ...