Labshake search
Citations for Sino Biological :
851 - 900 of 945 citations for Mouse Anti SARS Coronavirus Nucleoprotein Antibody 3863 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... a rabbit polyclonal antibody against influenza A/H5 HA (11062-T62, Sino Biological) ] ...
-
bioRxiv - Microbiology 2024Quote: ... a rabbit polyclonal antibody against influenza A/H7 HA (40103-T62, Sino Biological) a rabbit polyclonal antibody against influenza B/Yamgata lineage HA (11053-T62 ...
-
bioRxiv - Microbiology 2024Quote: ... a rabbit polyclonal antibody against influenza A/H1 HA (11055-T62, Sino Biological), a mouse monoclonal antibody against influenza A/H3 HA (11056-MM03 ...
-
bioRxiv - Immunology 2020Quote: ... rabbit anti-Nucleocapsid PAb (Sino Biological, #40588-T62), mouse anti-GAPDH mAb (monoclonal antibody ...
-
bioRxiv - Biochemistry 2020Quote: ... 50uL anti-M13/HRP conjugate (Sino Biological, 11973) were added and incubated for 30 min ...
-
bioRxiv - Microbiology 2021Quote: Mouse anti-Spike and anti-GAPDH were purchased from Genetex and Rabbit anti-N from Sino Biological (Clinisciences). The mouse anti-dsRNA antibody (J2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... anti-CD90/Thy1 from Sino Biological (Sino Biological); CD62P from Biolegend (San Diego ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-Rnd3 (1:1000; Sino Biological; 101056-T32). Secondary antibodies include Alexa Fluor 568 anti-mouse (1:500 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Chi3l1-/- mice treated with APAP were immediately injected (i.p.) with either PBS (100μl) or recombinant human Chi3l1 (rhChi3l1, 1μg/mouse in 100μl, Sino Biological 11227-H08H). After 3h ...
-
bioRxiv - Microbiology 2020Quote: ... a polyclonal rabbit antibody generated against full-length MERS-CoV N protein (Sino Biological), and a mouse monoclonal antibody (J2 ...
-
bioRxiv - Immunology 2021Quote: ... and stained with an antibody against the viral nucleocapsid protein (Sino Biologicals, #40143-R001) followed by a staining with the nuclear dye Hoechst 33342 (Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and stained with an antibody against the viral nucleocapsid protein (Sino Biologicals, #40143-R001) followed by a staining with the nuclear dye Hoechst 33342 (Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and stained with an antibody against the viral nucleocapsid protein (Sino Biologicals, #40143-R001) followed by a staining with the nuclear dye Hoechst 33342 (Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... a rabbit polyclonal antibody against influenza B/Yamgata lineage HA (11053-T62, Sino Biological), and a mouse monoclonal antibody against Influenza B/Victoria lineage HA (11053-MM06 ...
-
bioRxiv - Biochemistry 2021Quote: ... HIV-1 Gag p24 or actin using anti-V5 (for pseudovirion detection; V2660)/anti-S2 (for virion detection; Sino Biologicals; 40590-T62), anti-N (Sino Biologicals ...
-
bioRxiv - Microbiology 2021Quote: ... and probed with anti-S1 (Sino Biological, 40150-T62) and anit-GAPDH (Santa Cruz ...
-
bioRxiv - Microbiology 2022Quote: ... and probed with anti-S1 (Sino Biological, 40150-T62), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2024Quote: ... and rabbit anti-VP24 (Sino Biological, cat #40454-T46) antibodies were added at a 1:2000 dilution and incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNA of human CD47 and mouse CD47 with an HA-tag at the C-terminal were purchased from Sino Biological and Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... Samples comprised of a 1.4:1 molar ratio of mAbs (10 μg/mL) to mouse Fc-RBD (2.5 μg/mL, Sino Biological, 51.5 kDa) were complexed in kinetics buffer for 30 min at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... Transfected HEK293T cells were stained with Fixable Viability Dye (eBioscience) and incubated with mouse Fc-tagged recombinant human ACE-2 (Sino Biological). A secondary donkey anti-mouse antibody conjugated with AF647 was used for detection of surface expression ...
-
bioRxiv - Immunology 2020Quote: ... Binding analysis of captured murine IgG antibodies to S1-His or RBD-His (Sino Biological) was performed using a multi-cycle kinetic method with concentrations ranging from 25 to 400 nM or 1.5625 to 50 nM ...
-
bioRxiv - Microbiology 2021Quote: ... The following primary Antibody information were listed: SPIKE (40150-T62, Sino Biological, at 1:2000), NP (NB100-56576 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal against HIV-1 Gag-p24 antibody (11695-RB01) were purchased from Sino Biological Inc ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were labeled with the following antibodies:(CEACAM6-FITC at 10 μg/mL, Sino Biological 10823-R408R ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Antibodies against human PCNA (proliferating cell nuclear antigen, rabbit) were purchased from Sino Biological (China). DNase I recombinant RNase free was purchased from Roche Life Sciences (Germany).
-
bioRxiv - Microbiology 2020Quote: ... and rabbit anti-HA2 (catalog no. 86001-RM01; Sino Biological) antibodies ...
-
bioRxiv - Microbiology 2021Quote: ... and PE-anti-human PDGFRA (Sino Biological, 10556-MM02-P) for 30 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... anti-MERS-CoV-Spike (Sino Biological, 100208-RP02, 1:1000), anti-Renilla Luciferase (abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-CD147/basigin (10186-R125, Sino Biological, dilution 1:200), or anti-HA (H3663 ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-CD147/basigin (10186-R125, Sino Biological, dilution 1:1000), anti-β-tubulin (ab6046 ...
-
bioRxiv - Biochemistry 2021Quote: ... C5aR1−/− and C5aR2−/− mice on a C57BL/6J genetic background (n=5-15) were administered with recombinant mouse C5a (Sino Biological, China) at a dose of 50 μg kg-1 via intravenous injection (tail vein) ...
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were grown till 70-80% confluency and then treated for 48 hours with 1 μM recombinant mouse interferon gamma (Sino Biological, China). Treated cells were detached by trypsinisation and stained with antibodies against the MHC cell surface proteins.
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Immunology 2020Quote: ... Binding analysis of captured murine IgG antibodies to S1-His or RBD-His (Sino Biological Inc.) was performed using a multi-cycle kinetic method with concentrations ranging from 25 to 400 nM or 1.5625 to 50 nM ...
-
bioRxiv - Immunology 2020Quote: ... and then incubated with the antibody against CD14 (1:200 dilution, 10073-RP0, Sino Biological, China) for 1 h at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated with a rabbit (2019-nCoV) S1 antibody (1:50; Sino Biological, Duesseldorf, Germany) and then incubated for 1 hour at 37°C with secondary goat anti-rabbit antibodies conjugated with fluorescein isothiocyanate (FITC ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-Tf (1:2000, 11019-RP02, Sino Biological Inc, China) antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... and rabbit anti-MERS S1 (1:200; 40069-T52, Sino Biological). For immunofluorescence ...
-
bioRxiv - Immunology 2020Quote: ... anti-TGF-β1 (1:1□000, 50698-T48, Sino Biological, China), anti-IL-10 (1:1□000 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The cells were incubated with anti-Spike protein Rab (Sino Biological) at 1:1000 in blocking solution overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-C1-INH (1 µg/mL, Sino Biologicals, 10995-R018) or rabbit anti-human C1q (1:300) ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... cells were incubated with anti-ACE2 (Sino Biological, 10108-RP01-100) or isotype control (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 RBD fusion protein with the Fc region of mouse IgG1 at the C-terminus (RBD-Fc) was purchased from Sino Biological (Beijing, China), recombinant SARS-CoV-2 RBD with a C-terminal His-tag was purchased from Kactus Biosystems (Shanghai ...
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-Lipocalin-2/LCN2 (1:500, 50060-RP02; Sino Biological, China), mouse anti-NF200 (1:500 ...