Labshake search
Citations for New England Biolabs :
451 - 500 of 6948 citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... Colony PCR was used to screen surviving transformants for the presence of the 520-522 insert using primers spanning the insert junctions and amplification with Taq 2X Master Mix PCR Kit (New England Biolabs), as described by the supplier ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The targeted genomic locus was then PCR amplified with primers flanking the expected cutting site (Supplementary Table 3) using Q5 Hot Start High-Fidelity Polymerase (NEB). 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB) ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were gel-purified and quantitated and then used to make digoxigenin-labeled anti-sense probes using single primer PCR with Taq polymerase (New England Biolabs) in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience ...
-
bioRxiv - Microbiology 2019Quote: ... a multiplex tiling PCR was attempted using the previously published YFV primer scheme and 30 cycles of PCR using Q5 High-Fidelity DNA polymerase (NEB) as previously described (20) ...
-
bioRxiv - Genetics 2020Quote: ... was PCR-amplified with the LHAdGao23fw and LHAdGao23rev primers from genomic DNA using Phusion High-Fidelity DNA Polymerase (New England Biolabs), producing 1060bp PCR product ...
-
bioRxiv - Biochemistry 2020Quote: DNA templates for in vitro transcription were amplified by PCR using custom DNA primers (IDT) and Phusion Hot Start polymerase (New England BioLabs). 2.5 mL transcription reactions were assembled using 1000 µL PCR reactions as template (∼0.2 µM template DNA) ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids pSP64-L3 and pSP64-L3Δ as well as the derivatives carrying the UcUA mutations were used as templates for PCRs (for primers, see Supplemental Table S6) using Q5 DNA polymerase (NEB) to generate SP6 promotor-containing L3pre DNA fragments that end at the position of 3’-cleavage (after bp 198 ...
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene regions V3-V4 were amplified with primers 314F (5’-CCTAYGGGRBGCASCAG-’3) and 806R (5’-GGACTACNNGGGTATCTAAT-3’) with Phusion High-Fidelity PCR Master mix (New England Biolabs) and amplified products were verified using Agilent 5400 Fragment analyser ...
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were generated with the primers listed in Supplementary Table 2 using HF Phusion DNA polymerase (New England Biolabs).
-
bioRxiv - Microbiology 2020Quote: ... The ligation mixture was then used in a PCR reaction with primers 2569/2570 (Table 2) and Phusion DNA polymerase (New England BioLabs). PCR was carried out in 50 μl reactions for 3 min at 98°C followed by 30 cycles of 1 min at 98°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pre-amplified PCR products were transferred to 96-well plates and further amplified for an additional 13 cycles using custom Nextera dual-index primers and NEBNext High-Fidelity 2X PCR master mix (New England Biolabs). Individually barcoded libraries were pooled and purified on a single MinElute column (Qiagen) ...
-
bioRxiv - Bioengineering 2022Quote: pGRNA-sacB-endA was cloned by PCR-amplification of pGRNA-sacB-ccdB using primers 542 and 543 and subsequent circularization of the PCR product by Gibson assembly (New England Biolabs).
-
bioRxiv - Bioengineering 2022Quote: ... pGRNA-galK was linearized by PCR using primers 95 and 391 and assembled with the sacB-fragment by Gibson assembly (New England Biolabs).
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid hcm1 sequence was amplified by PCR for 21 cycles with vector specific primers using Phusion High-Fidelity DNA polymerase (New England Biolabs). Products were extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Genetics 2022Quote: NGS libraries were generated by amplifying 12 μl of the eluted CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (90) (Suppl. Table 4) with NEBNextHiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR was done with 1-2 ng of plasmid and 200 nM of each primer in Phusion High-Fidelity PCR Master Mix (New England Biolabs) with pre-denaturation at 98°C for 5 sec followed by 12 cycles of 98°C for 5 sec ...
-
bioRxiv - Microbiology 2022Quote: ... The sequencing ladders were obtained from hlgCB or hlgB PCR products (amplified with primers listed in Supplementary Table S2) and the Vent (exo-) DNA polymerase (NEB Biolabs). All samples were fractionated on a 10% polyacrylamide −8 M urea gel in 1x TBE ...
-
bioRxiv - Microbiology 2022Quote: ... we executed mutagenic PCR oligonucleotide primers KT1604 and KT1606 and the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) according to manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The sgRNA containing sequences of the genomic template DNA were amplified by PCR using the indicated Primers of HPLC grade (S2) and Q5 Hot Start high-fidelity DNA polymerase (New England BioLabs). The PCR products of the toxin resistant cells and untreated library cells were analyzed by deep sequencing using an Illumina-based procedure via a commercial supplier (Eurofins Genomics).
-
bioRxiv - Synthetic Biology 2023Quote: ... A 5 µL aliquot was taken in which primers and dNTPs were then inactivated using Exo-CIP Rapid PCR Cleanup Kit (NEB). From the resulting mixture ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of the resuspended pooled oligonucleotide library or NNK-based library was used as an initial reverse primer along with 0.5 μM AAV9_K449R_Forward primer in a 25 μL PCR amplification reaction using Q5 Hot Start High-Fidelity 2X Master Mix (NEB, M0494S). 50 ng of a plasmid containing only AAV9 (K449R ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA fragments were amplified by PCR using primers (TSINGKE Biological Technology) with 25–30-bp overlap and then assembled using T5 exonuclease (New England Biolabs), Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... IVT_T7_Forward and reverse primers were added to the product and PCR amplified using LongAmp Taq 2X Master Mix (NEB, M0287S) with the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... The DNA was then amplified by performing a multiplexed PCR in two pools using the ARTIC-N5 primers and the Q5 Hot Start DNA polymerase (New England BioLabs) (Itokawa et al.) ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... An insert downstream of aga2 was amplified from pYD2 using primers PK463+PK464 in a 1 ml PCR reaction (Q5 High-Fidelity 2X Master Mix, NEB), DpnI digested for 2 h and SPRI purified ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was then amplified using nested PCR (Primers in Table S3) with High-Fidelity Phusion or Q5 DNA polymerase (New England Biolabs), and the PCR products ligated into pGEM®-T Easy vector (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG) and the Phusion High-Fidelity DNA polymerase (New England Biolabs). The XBB.1.5(-G252V ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplified products (templates and primers presented in Table S8) were assembled by the NEBuilder HiFi DNA assembly (NEB, E2621L) to generate lenti-EMPTY-GFP ...
-
bioRxiv - Genetics 2023Quote: ... the region containing the target surrounded by the context was amplified by PCR using primers P7-P8 with Q5 Hot Start High-Fidelity 2× Master Mix (NEB) with the following conditions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR amplicons were run by electrophoresis on a 2% agarose gel to ensure the absence of primer-dimers and PCR samples for each primer pair-opsin target were purified using Exonuclease (EXO) and Shrimp alkaline phosphatase (SAP) (NEB) prior to Sanger Sequencing to confirm gene-specific amplification ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Immunology 2023Quote: ... Candidate founders giving positive products in all three PCR reactions were further characterised by amplifying again with the JG01 F/R primers using high fidelity Phusion polymerase (NEB), the larger product gel extracted and subcloned into pCRblunt (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... primers 972 and 973 were designed to amplify the fragment by PCR with Q5 polymerase and high-GC buffer (NEB). The barcode fragment and pKS1 were both digested with NcoI and BamHI and ligated with T4 DNA ligase (NEB ...
-
bioRxiv - Genomics 2023Quote: ... was cloned between residues 34 and 35 with primers ag424 and ag425 using inverse PCR with Q5 polymerase (New England Biolabs, NEB).23 The sequences of all primers used in this study are presented in Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... V3-V4 region of 16S rRNA gene was amplified using specific primers with the barcode and Phusion High-Fidelity PCR Master Mix (New England Biolabs). PCR products were mixed at equal density ratios ...
-
bioRxiv - Systems Biology 2023Quote: ... and used as the template for PCR with primers containing gene-specific targeting homology arms (1x Q5 Master Mix, New England Biolabs #M0494S ...
-
bioRxiv - Systems Biology 2023Quote: ... Each library was dissolved in 100µL Tris 10mM pH 8 and amplified by PCR with specific primers (Fw: GTGAACCGTCAGATCGCCTCGGCACTCCAGTCCT, Rv: AGAGGGTTAGGGATAGGCTTACCTCAGGCTAGTGCGGACCGAGTCG) using NEBNext Ultra II Q5 HotStart (NEB). PCR cycling parameters were set as follows ...
-
bioRxiv - Molecular Biology 2023Quote: 32P-labelled DNA fragments were generated by PCR using primers labelled with [γ-32P]ATP using T4 polynucleotide kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The 13 mutant LEP sequences containing specific point mutations were generated from the original sequence by carrying out PCRs with mutagenic primers and using a KLD enzyme mix (M0554S; NEB) to repair the vectors ...
-
bioRxiv - Cancer Biology 2023Quote: ... then split in 2 for PCR amplifications with either Minus or Plus primers using Q5 DNA Polymerase (New England Biolabs) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplification was performed using NEB primers for 15-16 cycles using the Q5 Hot Start HiFi PCR Master Mix (NEB). The PCR-amplified library was purified using Ampure XP beads and its quality was assessed on a Bioanalyzer 2100 system (Agilent) ...
-
Treg cells drive MYCN-mediated immunosuppression and tumor aggressiveness in high-risk neuroblastomabioRxiv - Cancer Biology 2023Quote: ... the sorted fish were fin-clipped to extract genomic DNA for PCR amplifications using gene-specific primers and Taq DNA polymerase (New England Biolabs). The following primers were used to identify fish harboring foxp3a mutations ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext® High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Developmental Biology 2024Quote: ... the AT1G65620/AS2 coding sequence (600 bps) was amplified from Col-0 cDNA using primers oLH111 and oLH112 by Phusion PCR (NEB), and cloned into pENTR™/D-TOPO™ (Invitrogen™) ...
-
bioRxiv - Genomics 2023Quote: ... all final Illumina compatible ERα STARRseq and ERα-focused STARR-seq capture libraries were prepared by PCR amplification (7 cycles) with NEBNext universal and single indexing primers (NEB), and were sequenced on Illumina NovaSeq 6000 (150bp Paired-End).
-
bioRxiv - Developmental Biology 2023Quote: ... The Sox2(600bp)::GFP plasmid was generated by digesting the primer overhangs of the PCR product with XhoI and EcoRV (NEB) and its consequent ligation into linearised plasmid ISceI/MCS-d1GFP-SV40/ISceI ...
-
bioRxiv - Molecular Biology 2024Quote: ... the double-stranded (ds) cDNA was PCR amplified with primers directed against 5’ and 3’ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB ...
-
bioRxiv - Immunology 2024Quote: ... The remainder of the adapter sequences were added to the heavy and light chains separately by a two-step PCR reaction with Q5 using the NEBNext index primers (NEB) 98°C for 30s ...
-
bioRxiv - Neuroscience 2024Quote: ... The final cDNA sample was then split into 16 separate reactions for final PCR amplification using 16 unique Illumina indexing primers and Q5 Hot Start High-Fidelity 2X Master Mix (NEB). After amplifications ...