Labshake search
Citations for New England Biolabs :
151 - 200 of 10000+ citations for rno mir 101a Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using the Luna universal one-step RT-qPCR kit (#E3005, New England Biolabs) according to the provided protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB) with the CDC-derived primers for N1 and N2 gene targets and the reaction was performed using the QuantStudio™ 5 System (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: RT-qPCR experiments were performed with the Luna® Universal One-Step RT-qPCR Kit (NEB, #E3005E) with a final reaction volume of 10 μL per well ...
-
bioRxiv - Cell Biology 2023Quote: ... Mammalian cell lines were handled under sterile conditions using a laminar flow hood and the cells were regularly tested for mycoplasma contamination with a PCR-based mycoplasma detection kit (Minerva-Biolabs, cat.no. 11-1250). Subcultivation was performed every 2-4 days at a confluence of maximum 80 % using trypsin (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription and quantitative PCR were performed in one step using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs, Ipswich, MA, USA). The primers used are listed in supplemental table (Table ...
-
bioRxiv - Molecular Biology 2022Quote: ... We generated cDNA with random hexamers for qRT-PCR) or oligo(dT) primers for RT-PCR using M-MLV (NEB). We carried out semi-quantitative RT-PCR using DreamTaq (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (New England Biolabs). The samples were analyzed using a Lightcycler 480 instrument (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England BioLabs) in a total volume of 20 µl and a template concentration of 50 ng/µl according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA synthesis and RT-qPCR was carried out using Luna® Universal One-Step RT-qPCR Kit (NEB) according to the manufacturer’s instructions with 100 ng of mRNA ...
-
bioRxiv - Neuroscience 2024Quote: One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England Biolabs) in a total volume of 10 µl and a template concentration of 50 ng/µl according to manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-PCR analysis was performed using Luna® Universal qPCR Master Mix (NEB) and Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... and RT-PCR was performed with Phusion High Fidelity DNA polymerase master mix (NEB) each with the manufacturer recommended PCR thermal cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... and converted to cDNA using random primers and M-MuLV RT-PCR enzyme (NEB). Proinsulin-specific primers (GTGAACCAGCACCTGTGC Fw and CGGGTCTTGGGTGTGTAGAAG Rv ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA synthesis was performed using LunaScript RT SuperMix Kit (NEB). Polymerase chain reactions were carried out using TaqMan 2X Universal PCR Master Mix or SYBR Green PCR Master Mix (Thermo ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was performed using LunascriptTM RT Supermix Kit (NEB) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... Luna Universal One-Step RT-qPCR kit (New England Biolabs) was used following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription was performed using LunaScript RT SuperMix Kit (NEB). Oligonucleotides used for qRT-PCR are listed in Supp ...
-
bioRxiv - Bioengineering 2022Quote: ... cDNA was generated using LunaScript RT Master Mix Kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Luna® Universal One-Step RT-qPCR Kit from NEB was used for RT-qPCR reactions ...
-
bioRxiv - Microbiology 2023Quote: ... and cDNA generated using LunaScript® RT Supermix kit (NEB). qPCR was performed using Luna® Universal qPCR Master Mix (NEB ...
-
bioRxiv - Genetics 2023Quote: ... The Luna Universal Probe One-Step RT-qPCR kit (NEB) following the manufacturer’s protocol was used for the quantification of IBV derived RNA using IBV specific primers (forward 5′-GCTTTTGAGCCTAGCGTT-3′ and reverse 5′-GCCATGTTGTCACTGTCTATTG-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the Luna Universal One-Step RT-qPCR Kit (NEB), and then analyzed with QuantStudio Design & Analysis Software v.1.5.1 ...
-
bioRxiv - Bioengineering 2024Quote: ... The LunaScript Primer-Free RT Master Mix Kit (NEB E3025S) was used to generate cDNA per manufacturer protocol ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Frankfurt am Main, Germany) and a CFX96 Real-Time System ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and RT-qPCR was performed using the Luna Universal Onestep RT-qPCR kit (New England Biolabs, Ipswich, Massachusetts, USA) on a Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (M300, New England Biolabs). The samples were analyzed using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed in 384 well format with Luna Universal Probe One-Step RT-qPCR Kit (NEB), assaying Fluc (primers oHR711/712 ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCR was conducted in technical triplicate using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to the manufacturer’s instructions in 10 µl reaction volumes and reactions were run on a CFX Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using Luna® Universal Probe One-Step RT-qPCR kit (E3006L; New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using Luna® Universal Probe One-Step RT-qPCR kit (E3006L; New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2023Quote: ... and the RT-qPCR master mix prepared using a Luna Universal One-Step RT-qPCR Kit (New England Biolabs), as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene-specific primers were used on cDNA (OneTaq One-Step RT-PCR, New England Biolabs) to evaluate aberrant transcript splicing via gel electrophoresis ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-PCR was performed using the Phusion® High-Fidelity DNA Polymerase (NEB, Evry, France) according to the manufacturer’s protocol in a 50-μl reaction mixture using forward primer 5’-ATGGATGTATGCGTCCGTCT-3’ and reverse primer 5’-CTACTTCTTAAGAGGCTTCT-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-PCR was performed with 10 ng of total RNA using OneTaq (New England Biolabs) PCR reaction system with the primers listed in Table S3 ...
-
bioRxiv - Neuroscience 2023Quote: Quantitative (q) RT-PCR was carried out using the Luna Universal qPCR Master Mix (NEB) in the CFX384 Real-Time system (Bio-Rad ...
-
bioRxiv - Genomics 2022Quote: ... The RNA samples and standards were amplified using the Luna® Universal Probe One-Step RT-PCR Kit (E3006, BioLabs®Inc, Ipswich, Massachusetts, USA), with 0.6 mM primer and 0.2 mM probe concentrations (Table S4) ...
-
bioRxiv - Bioengineering 2020Quote: ... We added 1 μL of the resulting DNase digestions to 10 μL RT-qPCR reactions (Luna One-Step Universal RT-qPCR Kit, New England Biolabs) containing 0.8 U/μL RNasin Plus (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... 4μL purified RNA were subsequently used for RT-qPCR reaction using the Luna Universal One-Step RT-qPCR kit (New England Biolabs) and 0.4μM of each primer ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe (Corman et al. ...
-
bioRxiv - Microbiology 2021Quote: ... RNA levels of target proteins were subsequently quantified by using RT-with the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermocycler using gene-specific primers ...
-
bioRxiv - Immunology 2020Quote: ... We quantified RNA using a one-step RT qPCR reaction with the NEB Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probes (SARS-CoV-2 E_Sarbeco and hamster RPL18 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Other G2L4 and GII RT mutant plasmids were derived from pMal-G2L4 RT or pMal-GII RT by using a Q5 mutagenesis kit (New England Biolabs).
-
bioRxiv - Microbiology 2022Quote: Detection of viral genomes from heat-inactivated samples was performed by RT-qPCR using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 specific primers targeting the N gene region (5′-TAATCAGACAAGGAACTGATTA-3′ and 5′-CGAAGGTGTGACTTCCATG-3′ ...
-
bioRxiv - Genetics 2023Quote: ... RT-qPCR was performed on 10 ng total RNA using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L). bin3 ...
-
bioRxiv - Systems Biology 2023Quote: ... RT-qPCR quantification was carried out on 20 ng of RNA with the Luna One-Step RT-qPCR Kit (NEB). All qPCRs were performed in technical triplicates ...
-
bioRxiv - Cell Biology 2022Quote: ... Editing efficiency was assessed using the EnGen Mutation Detection Kit (NEB) (E3321S ...
-
bioRxiv - Microbiology 2022Quote: ... PCR clean-up (Monarch PCR and DNA Cleanup Kit, NEB) and gel extraction (Monarch Gel Extraction Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR products were purified (Monarch PCR Cleanup Kit (NEB, #T1030S)) and restriction digested with unique 5’ SpeI and 3’ PspXI sites ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was done using LongAmp® Taq PCR Kit (NEB) from 40 ng of QMA0248 S ...