Labshake search
Citations for New England Biolabs :
151 - 200 of 302 citations for p53 Rabbit Polyclonal HRP labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: miRNAs were synthesized by IDT and radio-labeled at the 5’ end with T4 polynucleotide kinase (NEB) and (γ-32P ...
-
bioRxiv - Microbiology 2022Quote: ... The glpFKD promoter fragments were labeled with 32P using DNA Polymerase I Large Fragment (Klenow fragment) (NEB) to fill in the 5’ overhang with [α-32P]dATP ...
-
bioRxiv - Developmental Biology 2023Quote: ... Digoxigenin-labeled antisense Alk3 RNA probe was prepared by linearization with EcoR1 (New England Biolabs, Ipswich, MA) and transcription with T7 RNA polymerase (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of SNAP-Surface Alexa Fluor 546 (1:1000, New England Biolabs) to DMEM F12 without serum and phenol red (21041-025 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digested DNA fragments were filled in with biotin-labeled dATP by incubating with Klenow enzyme (NEB, M0212), biotin-14-dATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L). Samples were separated using 4–12% BisTris-PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rabbit anti-DYKDDDDK (#D6W5B; NEB) and rabbit anti-myc (#71D10 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... rabbit anti-SNAP-tag (NEB; P9310 ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... The membrane was incubated with HRP-conjugated (1/2,500 New England Biolabs, Ipswich, MA) or IRDye® (1/10,000 LI-COR Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA was then 5’ end labeled in 24μL PNK wash buffer with 16μL of 1x PNK buffer (NEB) containing 150μCi of gamma P32-ATP ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: 3’-PUA-DNA was generated by incubation of 1 μM 5’-FAM-labeled AP-DNA (FAM_U_35) with 20 U EndoIII/Nth (NEB) in Buffer B pH 7.0 at 37 °C for 60 m ...
-
bioRxiv - Biophysics 2019Quote: ... Biotin- and digoxygenin-labeled handles were amplified with a non-proofreading Taq DNA polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biophysics 2019Quote: ... Biotin- and digoxygenin-labeled handles were amplified with a non-proofreading Taq DNA polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genomics 2019Quote: ... Nicked DNAs were labeled at 72°Cfor 60 minutes using 15 U Taq DNA Polymerase (New Engand Biolabs) in 1× each Labeling Buffer and Labeling Mix (Bionano Genomics) ...
-
bioRxiv - Immunology 2020Quote: SNAP-ASC-CARD and CASP1-CARD-SNAP monomers that were labeled with Alexa Fluor 647 (New England Biolabs) were co-incubated with CARD domain only filament seeds (CARD8-CARD without SNAP ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA probes (Extended Table 1) at 500 nM were 5’-[32P]-labeled using T4 Polynucleotide Kinase (NEB) and hybridized to the membrane overnight at 37°C in PerfectHyb™ Plus Hybridization Buffer (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... this extension could be radioactively labeled by filling in the overhangs using 32P-dCTP and Klenow enzyme (NEB). Sequences of the +-strand oligonucleotides used are described in Table 1.
-
bioRxiv - Cell Biology 2023Quote: ... Snap-tagged human β1AR and β2AR constructs were labeled with Snap-cell 647 SiR (New England Biolabs, S9102S) at 1:1000 concentration for 20 min at 37°C in DMEM without phenol red supplemented with 30 mM HEPES ...
-
bioRxiv - Cell Biology 2023Quote: ... A stock solution of these oligos (1μl of a 10μM) was 5’-end-labeled using T4PNK (NEB®) and 5μl of ATP ...
-
bioRxiv - Cancer Biology 2021Quote: ... membranes were hybridized with primary and HRP coupled secondary antibodies (New England Biolabs, Ipswich, MA). Membranes were revealed by chemiluminescence with SuperSignal West Dura or Femto reagents and data acquired using the G-BOX-iChemi Chemiluminescence Image Capture system (Syngene ...
-
bioRxiv - Microbiology 2019Quote: ... rabbit α-Gaussia Luc (E80235, NEB), rabbit α-PB1 (PA5-34914 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and rabbit anti-myc (#71D10; NEB) primary antibodies were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE ...
-
bioRxiv - Microbiology 2019Quote: ... 1 pmol of DNA template was mixed with 10 pmol of oligonucleotide 9 labeled with Yakima Yellow and 1µL of HemoKlen Taq DNA Polymerase (New England Biolabs) in a 6µL reaction mixture containing 50 mM Tris-HCl pH 9.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... S121A or triple mutant (AAA)) was incubated and labeled in vitro with 2U of CK2 (New England Biolabs, P60105) in a 30µl reaction containing 3pM adenosine triphosphate (ATP) ...
-
bioRxiv - Biophysics 2021Quote: ... All proteins were purified and labeled with BG-surface Alexa 647 and BC-surface Dy547 dyes (New England Biolabs) as previously described (Murayama and Uhlmann ...
-
bioRxiv - Microbiology 2022Quote: ... Oligonucleotides complimentary to the target were end-labeled with γ-32P-ATP by T4 polynucleotide kinase (New England Biolabs). Labeled oligonucleotides were added to the membrane and incubated overnight at 45°C ...
-
bioRxiv - Biochemistry 2019Quote: ... All sens RNA strands were labeled at their 5’ end with [γ-32P] ATP using protein nucleotide kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: INS-1 832/3-SNAP-GLP-1R cells on Thermanox coverslips (Agar Scientific) were labeled with 2 μM SNAP-Surface-biotin (a gift from Dr Ivan Corrêa Jr, New England Biolabs), and 5 μg/ml NaN3-free Alexa Fluor 488 Streptavidin ...
-
bioRxiv - Molecular Biology 2020Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Genetics 2020Quote: ... Open chromatin DNA was labeled with biotin by incubating the nuclei in presence of 2.5 U of Nt.CviPII (NEB, R0626S), 50 U of DNA polymerase I (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... new SNAP-tagged histones were pulse-labeled for 30 min with 5 μM final SNAP-biotin (New England Biolabs) diluted 1:200 in 10% Duolink blocking buffer (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Oligonucleotide probe for telomere or Alu repeats was labeled with [32P]-ATP (3,000 Ci/mmol) and T4 nucleotide kinase (New England Biolabs). The membrane was hybridized in Church hybridization buffer containing a 32P-labeled probe at 42°C overnight ...
-
bioRxiv - Biophysics 2023Quote: RNAs were labeled with γ32P-ATP using T4 polynucleotide kinase (PNK) according to the manufacturer conditions (New England Biolabs). Radioactive RNAs were separated from any non-incorporated γ32P-ATP via denaturing 15% polyacrylamide (19:1 ...
-
bioRxiv - Genomics 2023Quote: ... cells in the latter plate were labeled with HaloTag Oregon Green and SNAP-Cell 647-SiR (New England Biolabs) simultaneously according to the manufacturers’ protocols ...
-
bioRxiv - Biophysics 2023Quote: ... We then sequentially labeled Nup96 proteins with SNAP ligand conjugated Alexa Fluor 647 (BG-AF647, S9136S, New England Biolabs) and mitochondria with primary anti-Tomm20 antibodies (rabbit polyclonal ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was labeled by fill-in of EcoRI overhangs with the DNA polymerase I Klenow fragment (New England Biolabs) in the presence of [α-32P] dATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2023Quote: Isotope labeled firefly luciferase (Fluc) mRNA was synthesized by HiScribe T7 High Yield RNA Synthesis Kit (E2040S, NEB, Ipswich) using stable heavy isotopes of ATP and CTP (NLM-3987-CA and CNLM-4267-CA-20 ...
-
bioRxiv - Plant Biology 2023Quote: ... a CP29A specific rabbit antisera (Kupsch et al., 2012) or anti-SNAP rabbit antisear (NEB, Frankfurt, Germany) in 1:2000 dilution overnight at 4°C and subsequently washed with TBST buffer four times at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... genomic DNA from the polyclonal parasites that returned from transfection was digested with BamHI and SpeI (New England Biolabs) and transferred to membrane (Nytran SuPerCharge ...
-
bioRxiv - Microbiology 2022Quote: ... the membranes were hybridized overnight with antisense oligo probes listed in the S6 Table end-labeled with T4-PNK (New England Biolabs) using 32P-γ-ATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SNAP-tagged histones neosynthesized during the chase time were pulse-labeled by incubating cells with 2 μM of red-fluorescent SNAP reagent (SNAPcell TMR star, New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE, NEB) in the presence of GTP and S-adenosylmethionine (SAM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Microbiology 2021Quote: ... was dephosphorylated and 5’ end labeled with P32 as follows: 25 pmol of RNA was dephosphorylated using 50U of Antarctic Phosphatase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the strands of each sequence was then labeled with P32 as follows: 10 pmols of single stranded DNA was incubated with 5 Units of T4 PNK (NEB) and 0.64µCi of P32- γ -ATP (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-protein complexes were radioactively labeled with 32P-γ-ATP (20 μCi) using 40U T4 Polynucleotide Kinase (New England Biolabs) in supplied PNK buffer for 30 min at 37ºC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...