Labshake search
Citations for New England Biolabs :
1 - 50 of 302 citations for p53 Rabbit Polyclonal HRP labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... was detected by addition of 1 nM Europium-labeled anti-p53 phosphoserine 15 antibody (New England Biolabs/ Cisbio) and 40 nM streptavidin-conjugated APC (Prozyme ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs), or mouse monoclonal anti-β-actin antibody (A5316 ...
-
bioRxiv - Genetics 2023Quote: ... and anti-rabbit HRP conjugated (NEB #7074) and anti-mouse HRP conjugated (Cell Signaling Technologies #7076 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal anti-SNAP-tag (New England BioLabs, P9310S), mouse monoclonal anti-HSP90 (BD Transduction Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... the membrane was incubated with HRP-conjugated secondary antibody (goat anti-rabbit HRP, BioLabs 7074P2) in 3% BSA in PBS-T shaking for 1-2 h at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... We used rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs), mouse monoclonal anti-CaM Kinase II α subunit antibody (05-532 ...
-
bioRxiv - Biochemistry 2023Quote: ... custom-made rabbit polyclonal anti-AcK142 or anti-AcK226 (Ez Biolabs) Abs were incubated overnight at 4 °C with the lysate from mock vs ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-SNAP (1:1000, polyclonal, New England Biolabs, Ipswich, MA, P9310S), or mouse anti-tubulin (1:40,000 ...
-
bioRxiv - Biochemistry 2021Quote: ... membranes were probed with rabbit polyclonal anti-pansuccinyllysine antibody (PTM Biolabs, PTM-401) at a dilution of 1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Using 10 μg of custom-made rabbit polyclonal anti-AcK142 Ab (Ez Biolabs), AcK142 PNKP was IP’d from 1 mg of GO-treated chromatin fraction from WT-PNKP-FLAG and K142R-PNKP-FLAG expressing cells ...
-
bioRxiv - Immunology 2022Quote: ... As an isotype control an unspecific polyclonal rabbit antibody was used (NEB, Frankfurt, Germany). To block ORF8 during differentiation it was preincubated with the polyclonal rabbit anti-ORF8 antibody or isotype over night and added to the monocytes (t=0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Rabbit polyclonal anti-SNAP-tag (Cat no. P9310S, New England Biolabs, 1:1000 dilution). Secondary antibodies used were ...
-
bioRxiv - Immunology 2020Quote: ... before being incubated with alkaline phosphatase-labeled anti-rabbit IgG (New England Biolabs, Beverly, MA).
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: SNAP-GCGR was detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/500) followed by goat anti-rabbit IgG H&L HRP (ab6271 ...
-
bioRxiv - Neuroscience 2021Quote: ... was separated into low-protein absorption tubes (PROKEEP; Watson Bio Lab, Tokyo, Japan) and reacted with 2 μg of rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs) or normal rabbit IgG (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were resolved by SDS-PAGE in urea loading buffer and analysed by Western blot against the SNAP-tag (rabbit polyclonal anti-SNAP-tag antibody P9310S, New England Biolabs) to detect levels of SNAP-GLP-1R in the different fractions ...
-
bioRxiv - Biochemistry 2023Quote: ... Bleo-treated WT-PNKP-FLAG and K226R-PNKP-FLAG cells using 10 μg of custom-made rabbit polyclonal anti-AcK226 Abs (Ez Biolabs). All other subsequent steps and buffers used for IP were the same as described earlier (17,18) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...
-
bioRxiv - Cell Biology 2022Quote: ... SNAP-GLP-1R and SNAP-GIPR were detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/1,000) followed by goat anti-rabbit HRP secondary (ab6271 ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... or radio-labeled Msp1-digested pBR322 (NEB). Membranes were hybridized with complementary RNA probes ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR-amplified ER-mRFP was cloned into pLenti6/V5-p53_wt p53 (gift from the Muranen lab) by double restriction enzyme digestion with BamHI-HF (New England Biolabs, R0136) and AgeI-HF (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR-amplified HMGCR was cloned into pLenti6/V5-p53_wt p53 (gift from the Muranen lab) by double restriction enzyme digestion with BamHI (New England Biolabs, R0136) and XhoI (New England Biolabs ...
-
bioRxiv - Genetics 2024Quote: ... Cas9, a homology repair template that was amplified using sequences (P52, P53) (Phusion High-Fidelity DNA Polymerase, New England BioLabs), which amplifies the 3′utr + 50bp of bli-1 ...
-
bioRxiv - Biophysics 2022Quote: Open complexes were pre-formed by incubating an excess of RNAP holoenzyme (>1.7 nM active) with <400 pM γ-32P-labeled promoter DNA (labeled with T4 polynucleotide kinase from NEB) in BB at 37 °C for at least 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... radioactively labeled using Klenow fragment (New England Biolabs) and [α-32P]dCTP ...
-
bioRxiv - Microbiology 2022Quote: ... and end- labeled using T4 polynucleotide kinase (NEB) with [γ-32P] ATP (Perkin Elmer) ...
-
bioRxiv - Genomics 2019Quote: ... labeled DNA was repaired with Taq ligase (NEB) at 37 °C for 30 min to restore integrated double strands DNA ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... Probe was labeled with T4 PNK (NEB M0201S) at 37°C for 1 h in a reaction containing 20 pmol probe ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA Probes were labeled with DIG (New England Biolabs) or DNP-11-UTP (Perkin Elmer ...
-
bioRxiv - Genomics 2020Quote: ... Biotin labeled dATP (Thermo,19524016) and Klenow (NEB, M0210) were used to fill restriction fragment overhangs ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... the FLAG eluate was labeled with SNAP-Surface549 (NEB) by incubating 3x molar excess of dye at 4°C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5’ end-labeled using T4 polynucleotide kinase (NEB) and [γ-32P] ATP ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1M cells were labeled with SNAP-Surface 647 (NEB) following manufacturer’s recommendation (50 μM concentration of SNAP-Surface 647 in complete cell media ...
-
bioRxiv - Developmental Biology 2023Quote: ... and end-labeled using T4 polynucleotide kinase (M0201, NEB) and [γ-32P] ATP (NEG002A250UC ...
-
bioRxiv - Microbiology 2020Quote: ... and β-actin (13E5, HRP-conjugated, NEB). Membranes were washed with TBS-T and incubated with HRP-linked secondary antibodies prior to detection with Clarity-ECL chemiluminescence reagent (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Genomics 2019Quote: ... and labeled using the enzyme Nt.BspQI (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genomics 2019Quote: ... and labeled using the enzyme Nt.BspQI (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2019Quote: ... cells were labeled with CLIP-Surface 547 (NEB, catalog S9233S) and SNAP-Surface Alexa Fluor 647 (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... Telomere probe was labeled using T4 polynucleotide kinase (NEB M0201) and <ι>γ-P32-ATP (Perkin Elmer NEG035C ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were pulse-labeled with SNAPcell-505 (1 µM; NEB) for 20 min in media ...
-
bioRxiv - Biochemistry 2022Quote: ... and labeled with [γ-32P]ATP by T4 PNK (NEB), followed by gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... and 7SK (GTGTCTGGAGTCTTGGAAGC) were radioactively labeled using T4 PNK (NEB) and ∼10x106 cpm of each probe were added to the membrane ...