Labshake search
Citations for New England Biolabs :
351 - 400 of 6947 citations for hsa mir 940 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and Ribonucleotide Solution Set (NEB, USA). During development phase ...
-
bioRxiv - Microbiology 2019Quote: ... Eluted DNA was transferred to a new tube and PCR enrichment of the adaptor ligated DNA was performed using NEBNext Multiplex Oligos for Illumina (Set 1, NEB #E7335). The PCR reaction mix was assembled according to manufacturers’ recommendations and placed in a thermal cycler set to the recommended conditions ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 ng of gDNA were used to set up a PCR using Phusion® High-Fidelity DNA Polymerase (New England BioLabs). The PCR product was separated in a 1% agarose gel by electrophoresis ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then the oligos went through PCR with KAPA HiFi HotStart Uracil+ Ready Mix and NEBNext Multiplex Oligos for Illumina Set 1 (NEB #E7600) as primers ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were first designed to use Phusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) to amplify the coding sequence of the desired TGLO and add a T7 promoter to the gene ...
-
bioRxiv - Genomics 2019Quote: ... Pools were PCR amplified using 10uM Illumina primer pair (F+R) and 2X Phusion Master Mix (NEB #M0531), temperature cycling consisted of 98°C for 30s ...
-
bioRxiv - Genomics 2020Quote: ... Five identical 50μl PCR reactions with pooled inserts and primers EF40 and EF41 were performed using Phusion (NEB), cycling conditions were 98°C 1min ...
-
bioRxiv - Cancer Biology 2022Quote: DNA fragments were generated by conventional PCR (primer sites underlined) supplementing the reaction with either methylated (NEB, N0356S) or un-methylated cytosine (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 µL of PCR product from the inner primer amplification was cleaned used 0.5 µL Exonuclease I (NEB) and 1 µL rSAP (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: SP graftings were performed using overhanging primers to the various V-genes via PCR using Q5 polymerase (NEB) with the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon-containing fragments were enriched by PCR using ComP7 primers ComP5 using Phusion DNA polymerase (New England Biolabs) in a 20-cycle reaction ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification primers were design with the complementary overhangs necessary for Gibson assembly using NEBuilder (New England Biolabs). The sequence for the forward primer was ...
-
bioRxiv - Genomics 2021Quote: Primers were used to amplify individual subpools using 25 µL 2x NEBnext PCR master mix (New England Biolabs), 2 µL of oligonucleotide pool (-40 ng) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10uM Illumina compatible forward and reverse PCR primers were added together with Q5 master mix (NE Biolabs, M0544S) followed by Ampure XP purification with 1:1 ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... a 30 cycle PCR amplification was performed using the Biotin_Short_pHIMAR and NC102 primers (Table S3) using Q5 mastermix (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 30 cycles (15 seconds 98°C ...
-
bioRxiv - Systems Biology 2021Quote: ... Adaptors for Illumina sequencing were added via PCR amplification using Nspacer_barseq_pHIMAR (Wetmore et al., 2015) and NEBNext Index 3 Primer for Illumina (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 4 cycles (15 seconds 98°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Fragments were created by PCR with the relevant primers (listed in Supplementary Table 2) using Q5 polymerase (NEB) and genomic DNA templates obtained from the Liebniz Institute [dsmz.de] ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Genetics 2020Quote: ... Primers were used to amplify individual subpools using 25 μL 2x NEBnext PCR master mix (New England Biolabs), 2 μL of oligonucleotide pool (~40 ng) ...
-
bioRxiv - Immunology 2022Quote: ... and subsequently amplified with Nextera sequencing primers and NEB high fidelity 2X PCR master mix (New England Biolabs) for 11 cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Successful heterozygous deletion lines were identified using the PCR primers CCCCCACCCATCAGTCATTC and GGTTGTGCCTCATAGTGCCT and Q5 Polymerase (NEB M0491S). Edited lines showed a 2.4kB band corresponding to the deletion allele in contrast to the 3.6kB unedited ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cDNA was used for PCR with primers nCoV-96_L/nCoV-96_R (Table S4) and Q5 polymerase (NEB). DNA was purified using magnetic beads (Omega Bio-tek ...
-
bioRxiv - Genomics 2023Quote: Primers were used to amplify individual subpools using 25 μL 2x NEBnext PCR master mix (New England Biolabs), 2 μL of oligonucleotide pool (∼40 ng) ...
-
bioRxiv - Molecular Biology 2023Quote: ... we PCR amplified ars1 (Heyer et al. 1986) from pMZ379 with primers 439 & 440 and Gibson assembled (NEB) this with a pUC57 or pBN111 backbone amplified with 437 & 438 ...
-
bioRxiv - Genomics 2023Quote: Primers were used to amplify individual subpools using 25 μL 2x NEBnext PCR master mix (New England Biolabs), 2 μL of oligonucleotide pool (∼40 ng) ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Microbiology 2024Quote: ... non incorporated primers were removed using the Monarch PCR and DNA clean up kit (New England Biolabs, T1030), using a binding buffer ratio to DNA of 3:1 ...
-
bioRxiv - Neuroscience 2024Quote: Mouse Hapln1 (NM_013500) was cloned into the pAAV vector by PCR with the following primers and ligase (NEB) or In-Fusion cloning (Takara) ...
-
bioRxiv - Immunology 2024Quote: The second PCR step added NEBNext unique dual index primers onto the ends of the amplicon (NEB, #E6440S). This was achieved by a two-step PCR reaction containing the same reagents as in the first PCR step except the primers were 5 µl of the supplied unique dual index primer mix ...
-
bioRxiv - Microbiology 2020Quote: ... The RT-PCR reactions were carried out using Luna Universal qPCR Master Mix (New England Biolabs, https://www.neb.ca) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... a semi-quantitative RT-PCR reaction was performed using Q5 Hot Start High-Fidelity DNA polymerase (NEB, M0493S) in a LabCycler thermocycler (SensoQuest) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extracted RNA from light and heavy fractions were subjected to qRT-PCR using Luna RT-qPCR kit (NEB).
-
bioRxiv - Microbiology 2023Quote: ... cDNA synthesis and qRT-PCR were performed simultaneously using the Luna Universal One-Step RT-qPCR kit (NEB) with the Quantstudio 7 Flex (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: PCR was carried out using NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs, E3006) or Taqman Fast Universal PCR master mix (Applied Biosystems ...
-
bioRxiv - Biophysics 2021Quote: ... Each fragment was produced by PCR using primers containing the restriction recognition sites for enzymes BbsI and BsaI (NEB), which recognize asymmetric DNA sequences and cut outside of their recognition sequence ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR amplification was run for 15 cycles and NEBNext Index1-24 primers for Illumina were used (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... together with the Bakt_314F (CCTACGGGNGGCWGCAG) and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina ...
-
bioRxiv - Biochemistry 2021Quote: ... The insert and pAC5.1 vector were amplified by Q5 DNA polymerase-based PCR using primers designed by NEBuilder (New England Biolabs), with the standard parameters changed to provide 30 bp overlaps at the junction of the fragments ...
-
bioRxiv - Molecular Biology 2021Quote: ... F1 dumpy animals were isolated and genotyped by PCR with let-7_SEQ_F5/R5 primers followed by an analysis of the PCR product using restriction digestion using EcoRV (NEB, Cat:N3195) and Sanger sequencing as described in (Duan et al. ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was amplified for transcription by PCR using custom DNA primers and Phusion Hot Start polymerase (New England BioLabs). Transcription reactions were conducted using 500 μL PCR reactions as template into 5 mL transcriptions ...
-
bioRxiv - Neuroscience 2023Quote: Tail tip genomic DNA was PCR amplified with ATRX_RC gen F and ATRX_RC gen R primers and digested with FspI (NEB R0135S). FspI cuts the wild-type allele (product sizes ...
-
bioRxiv - Molecular Biology 2023Quote: ... HA-NONO mutants were PCR-cloned with primers (Supplemental Table S2) and a Q5 site-directed mutagenesis kit (NEB) using the manufacturer’s protocol and verified by sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Plant Biology 2023Quote: ... Mutations (D to V) of the MHD motif were carried out using inverse PCR with primers containing AarI (NEB) or BsmBI (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR was performed in a 25 μl volume with 0.08 μM primer concentration and NEBNext Q5 Hot Start HiFi PCR Master Mix (ref. M0543L, New England Biolabs). The cycling conditions were an initial denaturation of 30 s at 98°C followed by 5 cycles of 98°C for 10 s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Two pairs of primers were used to perform PCR amplification with Q5 High-Fidelity 2X Master Mix (NEB, #M0492S). All validation primers are listed in Supplementary Table 3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μL i7 unique index primer (10 μM) and 25 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB) were added to 21 μl of purified CUT&TAG DNA ...