Labshake search
Citations for New England Biolabs :
201 - 250 of 6947 citations for hsa mir 940 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... HiC DNA was amplified using PE PCR primers and Phusion DNA polymerase (NEB) for 7-9 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR conditions were followed according to each primer pair as recommended by NEB using pCMV-SMAUG1-HisTEV2xFLAG as the template ...
-
bioRxiv - Genomics 2023Quote: ... pOPO374 was linearized with primer introduced ends through PCR by Q5 polymerase (NEB). The resulting PCR product was then circularized by treatment with PNK (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... The M1879T mutant channel was constructed using site-directed mutagenesis PCR (Forward primer: AATACAGACGGAAGAGCGATTCATGGCATCAAACCC; Reverse primer: GCTCTTCCGTCTGTATTCGAAGGGCATCCATCTCTCC) with Q5 polymerase (New England Biolabs, Ipswitch, MA). The neonatal construct differed from the adult by inclusion of the neonatal exon 6N instead of the adult exon ...
-
Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasisbioRxiv - Microbiology 2021Quote: ... Digested product was used as a template to set up first PCR with Taq polymerase (NEB), 1X Taq buffer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and all PCR reactions were set up with Q5 Master Mix (New England Biolabs, Ipswich, MA) according to the manufacturer’s protocol.
-
bioRxiv - Genetics 2021Quote: ... RT-PCR was conducted using the Q5 High-Fidelity 2X Master Mix (NEB). All primers used in the current study are available in Table S1.
-
bioRxiv - Cell Biology 2022Quote: ... The purified RT-PCR products were double digested by BamHI and XbaI (NEB) and then ligated into pBiFC-Flag-VN or -YC vectors by T4 DNA ligase or when these two restriction enzymes had cut sites within the cDNA sequences ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR using Luna® Universal qPCR Master Mix (New England BioLabs) was performed with the following cycling conditions on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... Reverse-transcription PCR was then performed using LunaScript RT Master Mix Kit (NEB) using a gene specific primer ...
-
bioRxiv - Immunology 2023Quote: ... Luna Universal Probe One-Step RT-PCR kit (New England BioLabs, Ipswich, Mass) was used for target amplification ...
-
bioRxiv - Genetics 2021Quote: ... using the LTP library preparation kit and employing NEBNext multiplex oligos for Illumina index primer pairs set 1 (New England Biolabs, Ipswich, Massachusetts). Sequencing was performed using a NextSeq 500/550 mid-output v2.5 300 cycle cartridge (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Library preparations were performed using the NEBNext Ultra II DNA Library Prep Kit for Illumina with the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, Ipswich, Massachusetts). Library preparation followed the protocol outlined in Saeidi et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... the NEBNextUltra™ II Directional RNA Library Prep Kit for Illumina and the NEBNext® MultiplexOligos for Illumina® (Dual Index Primers Set 1) according to the manufacturer’s protocols (New England Biolabs, USA). Libraries were QC-checked on a Bioanalyzer 2100 (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... and use of a specific barcode from the NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 or 2 (New England Biolabs). Quality and quantity of total RNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR (qRT-PCR) was performed in duplicate with the Luna® Universal qPCR Master Mix (NEB, M3003) using QuantStudio 5 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Microbiology 2022Quote: ... Reverse-transcription polymerase chain reaction (RT-PCR) was performed using the Luna Universal Probe One-Step RT-qPCR kit (New England BioLabs; https://www.neb.ca). The 5 ‘ untranslated region (UTR ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized from 0.5-1 µg of RNA per sample using Protoscript II RT and Random Primer Mix (New England Biolabs). qPCR reactions were performed on cDNA using iQ SYBR Green supermix (BioRad) ...
-
bioRxiv - Immunology 2024Quote: ... The 16S rRNA gene spanning variable regions V3+V4 was amplified using the broad-range forward primer 341F: CCTAYGGGRBGCASCAG and the reverse primer 806R: GGACTACNNGGGTATCTAAT using the Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program consisted of (1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were amplified for 12 PCR cycles with unique dual index primers using the NEBNext Hi-Fi 2X PCR Master Mix (New England Biolabs). Amplified libraries were purified using a 1.2X ratio of Axygen magnetic beads (Corning Inc ...
-
bioRxiv - Microbiology 2022Quote: ... and amplicons were generated by PCR (primers 341F and 806R) using a Phusion High-Fidelity PCR Master Mix (New England Biolabs). Amplification product quality was assessed by gel electrophoreses and samples were pooled in equimolar ratios ...
-
bioRxiv - Genomics 2020Quote: ... 2.5uL reverse PCR primer (CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT) and 25uL NEBnext High-Fidelity 2x PCR Master Mix (New England Biolabs, MA, United States)) using thermo-cycler conditions described in 94 for a total of 9 cycles ...
-
bioRxiv - Immunology 2020Quote: ... The whole resulting product was then PCR-amplified using indexed primers with NEBNext High-Fidelity 2X PCR Master Mix (NEB). First ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Genetic parts were amplified using primers listed in Table S1 and PCR products were purified with the Monarch PCR & DNA Clean up kit (NEB). Parts were assembled into plasmid constructs mainly by Gibson assembly [41] using the isothermal method ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then amplified by PCR using custom nextera primers at 400 nM and NEBNext HiFi 2x PCR Master Mix (New England Biolabs) (Buenrostro et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1ul of cDNA was amplified by PCR with primers that amplify about 200 bp surrounding the sites of interest using OneTaq PCR Mix (NEB). The numbers of cycles were tested to ensure that they fell within the linear phase of amplification ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1ul of cDNA was amplified by PCR with primers that amplify about 200 bp surrounding the sites of interest using OneTaq PCR Mix (NEB). The numbers of cycles were tested to ensure that they fell within the linear phase of amplification ...
-
bioRxiv - Genomics 2022Quote: ... Transposed DNA fragments were amplified for 13 cycles in the presence of Custom Nextera PCR primers (Buenrostro et al., 2013) using the NEBNext High-Fidelity 2x PCR Master Mix (Cat. #M0541, New England Biolabs). Libraries were purified using the High Pure PCR Production Purification Kit (11732676001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina multiplex and bar code primers were added by PCR (1 µL of MMEJ product and 200 nM primers in Phusion High-Fidelity PCR Master Mix (New England Biolabs) with 98°C ...
-
bioRxiv - Microbiology 2022Quote: ... The linear recombineering product was PCR amplified from the resulting plasmid using Phusion High-Fidelity Polymerase and primers MRS09 + MRS10 and PCR purified using the Monarch PCR & DNA Cleanup Kit (T1030, NEB). M ...
-
bioRxiv - Genetics 2022Quote: ... The two PCR fragments were PCR-stitched with primers B1012 and B1366 and inserted by NEBuilder HiFi DNA Assembly (New England Biolabs) into MluI of pBN523 ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of cDNA was used in a 50 μl PCR reaction containing 1 μl of 10 μM PCR primer and 25 μl of 2x LongAmp Taq Master mix (NEB). PCR was performed as shown in Supplementary Protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Libraries were amplified for 12 PCR cycles with unique dual index primers using the NEBNext Hi-Fi 2X PCR Master Mix (New England Biolabs). Amplified libraries were purified using a 1.2X ratio of Axygen magnetic beads (Corning Inc ...
-
bioRxiv - Genomics 2023Quote: ... were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: ... the targeted tars-1 region was amplified by PCR (primer sequences in Supplemental Table 2) using Q5 PCR mix (New England Biolabs). Amplicons were then purified with DNA Clean and Concentrator kits (Zymo Research ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were PCR amplified with dual index barcode primers for Illumina sequencing (NEB E7600) using Q5 DNA polymerase (NEB M0491 ...
-
bioRxiv - Bioengineering 2021Quote: ... and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (NEB), using Kapa HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (NEB), using Kapa HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (NEB), using Kapa HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... PCR was then performed on genomic DNA with relevant primer pair and enzyme (NEB) (see materials and methods chapter for PCR programme) ...
-
bioRxiv - Genomics 2024Quote: ... and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (NEB), using Kapa HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were set up with 1 μL of genomic DNA and either Q5 DNA Polymerase (NEB) or LongAmp Taq (NEB ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... PCR mix and thermocycler conditions were set according to the Phusion Master Mix protocol provided by NEB. PCR products were measured and visualized using a D5000 ScreenTape System (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: Quantitative real-time PCR (qRT-PCR) was used to measure RNA with Luna Universal One-Step RT-qPCR Kit (New England Biolabs) via CFX Connect Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All DNA fragments were indexed using NEBNext Multiplex Oligos for Illumina (Dual Index Primer sets 1 and 2, New England Biolabs, Ipswich, MA, USA).
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: ... The NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® with the NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1) were used to generate DNA libraries for sequencing (New England Biolabs, USA) as per the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA library was PCR amplified using KAPA HiFi HotStart ReadyMix (FisherScientific, 50-196-5217) and NEBNext® Multiplex Oligos for Illumina® Dual Index Primers Set 1 (NEB, E7600S). The library was purified twice using 1x AMPure XP Bead (BeckmanCoulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... The library was PCR amplified using KAPA HiFi HotStart ReadyMix (FisherScientific, 50-196-5217) and NEBNext® Multiplex Oligos for Illumina® Dual Index Primers Set 1 (NEB, E7600S). The library was purified twice using 1x AMPure XP Bead (BeckmanCoulter ...
-
bioRxiv - Evolutionary Biology 2024Quote: We prepared dual indexed libraries according to the instruction manual using the NEBNext Ultra II DNA Library Prep Kit for Illumina and the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1, New England Biolabs, Ipswich, Massachusetts, USA) and following the recommended conditions of bead-based size selection according to distribution of DNA fragments per sample ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-PCR analysis was performed using Luna® Universal qPCR Master Mix (NEB) and Rotor-Gene Q (Qiagen) ...