Labshake search
Citations for New England Biolabs :
551 - 600 of 2731 citations for Who Coplanar & Mono Ortho Pcb + Pcb 170 & Pcb 180 13C12 99% 20 Ng Ml In N Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 900 ng RNA was depleted of rRNA using the NEBNext rRNA Depletion kit (NEB). RNA-seq libraries were prepared from an equal amount of ribo-depleted RNA using the NEBNext Ultra II Directional RNA Library Prep kit ...
-
bioRxiv - Biochemistry 2020Quote: ... 10-50 ng of mononucleosomal DNA was incubated with 1.25 Units Taq polymerase (NEB), 3.75 Units T4 DNA polymerase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and NGS libraries were quantified by qPCR using the NEBNext Library Quant Kit (NEB). Illumina sequencing was performed with a NextSeq mid-output kit with 150-cycle single-end reads and automated adaptor trimming and demultiplexing (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... 400 ng of RNA was digested by 5 U of RppH (New England Biolabs) for 2 h at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... ddPCR absolute quantification was performed using 15 ng of DraI or AluI (NEB, US) pre-restriction digested DNA in a 20ul reaction mix containing 1x ddPCR Supermix for Probes (BioRad ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 ng of isolated DNA was digested with MspI restriction enzyme (NEB, Ipswich, MA), carried out end-repair/adenylation (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... The final injection mix contained 300 ng/μL spCas9 protein (M0386, New England Biolabs), 40 ng/μL of each sgRNA (3 targeting exon 5 and 7 of Dicer2 and 4 targeting the kmo gene ...
-
bioRxiv - Biophysics 2023Quote: ... 100 ng or less template DNA and 24 μL Taq DNA polymerase (NEB M0273L). Purify and concentrate the PCR DNA product by ethanol precipitation ...
-
bioRxiv - Developmental Biology 2023Quote: ... Injection mixtures containing 500 ng/µl of Cas 9 protein (NEB; Cat. no.: M0641) and 300 ng/µl of guide RNA were prepared and injected into eggs within 4 hours of egg laying ...
-
bioRxiv - Molecular Biology 2023Quote: ... NGS libraries were pooled and quantified by qPCR using NEBNext Library Quant Kit (NEB). Sequencing was performed with NextSeq high-output kit with 75/150-cycle single-end reads and automated adaptor trimming and demultiplexing (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... ∼100 ng of RNA was treated with NEBNext rRNA Depletion Kit (New England Biolabs). RNA-Seq was performed using libraries prepared with NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... 500 ng of genomic DNA was digested with MspI+EcoRI and HpaII+EcoRI (NEB) in parallel reactions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Illumina NGS libraries were prepared using the NEBNext Ultra II DNA Kit (NEB, E7645S), and sequenced for 50-nt SE reads ...
-
bioRxiv - Genetics 2023Quote: ... and NGS libraries were quantified by qPCR using the NEBNext Library Quant Kit (NEB). Illumina sequencing was performed using the NextSeq platform with automated demultiplexing and adaptor trimming (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... RNA (200 ng) was reverse transcribed into cDNA using LunaScript®RT SuperMix (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: 12mer arrays (40 ng) were digested with 1 U of MNase (New England Biolabs) in a 10 μL reaction for varying digestion times (2.5 to 10 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... ∼300 ngs of genomic DNA were digested with 100U of MspI (New England Biolabs), and cleaned up using QIAquick PCR purification columns (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA (>300 ng) was reverse transcribed using the Lunascript RT Supermix Kit (NEB, E3010).
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10µg/ml) and apyrase (25mU/ml, NEB); the suspension was incubated for 1h at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... addition of a N-terminal Hemagglutinin (HA) epitope was done using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) following manufacturer recommendations.
-
bioRxiv - Genomics 2020Quote: ... libraries were quantified by qPCR using either the NEBNext® Library Quant kit (New England Biolabs, Cat. N: E7630S) or the KAPA Library Quantification Kit (scRNA-seq libraries only ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified on the streptavidin beads using the EpiMark Hot Start Taq (New England Biolabs, Cat. N: M0490) using following program ...
-
bioRxiv - Biochemistry 2020Quote: ... Glycans were incubated with different exoglycosidases in different sequences: (i) Streptococcus pneumonia β-N-acetylglucosaminidase (GUH, New England Biolabs); (ii ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Biophysics 2021Quote: ... 3 mM CaCl2 and 0.02% DDM) was incubated with 2000 units of N-glycosidase F (PNGase F) (New England BioLabs) at room temperature for 1 h ...
-
bioRxiv - Biophysics 2020Quote: N-terminal strep-6xHis-TEV mTagBFP2 RanQ69L was cloned into the pST50 vector via Gibson Assembly (New England Biolabs). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Sec24D was subcloned from pEGFP Sec24D into pcDNA3.1 with an N-terminal myc-6xHis tag using Gibson Assembly (E5510, New England Biolabs). pcDNA3.1 was linearized with Not1 (R3189 ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... The Cas9/gRNA expression construct pTREX-n-Cas9 was first modified using the Q5 mutagenesis kit (NEB, Ipswich, Massachusetts), primers 5’-CCCAAAAAGAAAAGGAAGGTTGATTAGAAGCTTATCGATACCGTCGAC-3’ and 5’-GTCCTCGACTTTTCGCTTCTTTTTCGGGTCGCCTCCCAGCTGAGA-3’ ...
-
bioRxiv - Microbiology 2019Quote: ... Pellets were resuspended in PBS and in some cases treated with N-glycosidase F (PNGase F; New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Neuroscience 2022Quote: Proteins from neuronal culture at DIV 14 were extracted as described above and treated with and without N-glycanase or endoglycosidase H according to manufacturer’s instructions (New England Biolabs). The lysates were analyzed with Western blot using LAMP1 (1:4000 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR analysis of total DNA extracted from oysters (N=60) used the high fidelity Q5 polymerase (New England Biolabs) in a total volume of 50 μL under the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning of the expression vector was performed using NEBuilder HiFi DNA Assembly Master Mix (Gibson cloning) and was performed according to manufacturer’s guidelines (cat. n° E2621L, New England Biolabs). In addition ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibody de-N-glycosylation was carried out by incubating the sample with PNGase F (New England Biolabs, Ipswich, MA) for 24 hrs at 37 OC (enzyme:substrate ratio ca ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Genetics 2021Quote: ... 20 μg of mpra:Δorf plasmid was linearized with AsiSI (NEB, R0630S) and 1x CutSmart buffer (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cas9 protein (New England Biolabs, #M0646M, EnGen Cas9 NLS 20 μM) and 300 pg of sgRNAs along with 5 ng of GFP cRNA were co-injected into the X ...
-
bioRxiv - Genomics 2020Quote: ... with 1 μl (20 U/μl) of DpnI restriction enzyme (NEB) in a final volume of 20 μl at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ ends were phosphorylated by 20 U polynucleotide kinase (PNK; NEB) by adding 1 mM ATP (Thermo Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Flow cells were treated with nuclease flush (20 µL DNaseI (NEB) and 380 µL nuclease flush buffer ...
-
bioRxiv - Biophysics 2019Quote: ... The reaction was supplemented with 20 units of DpnI (BioLabs ®) and incubated overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Genomics 2019Quote: ... then incubated with 20 U of BGT (NEB, Ipswich, MA, USA) in 1X NEBuffer 2 for 2 h at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 µL of 20 µM H2A/H2B dimer (New England BioLabs), and 50 µL of 10 µM H3/H4 tetramer (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.0125 µl Exonuclease I (20 U/µl; New England Biolabs, M0293S) and 2.3625 µl H2O per 10 µl PCR reaction ...
-
bioRxiv - Genetics 2022Quote: ... One 20 μl ligation reaction using T4 ligase (New England Biolabs) was carried out using 0.9 ng of the gel-purified insert and 500 ng of the vector ...