Labshake search
Citations for New England Biolabs :
701 - 750 of 3908 citations for Thymidine Kinase 1 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented via ultrasound (4 pulses a 30 sec, 4 °C) and subsequently treated with T4 Polynucleotide Kinase (NEB). Half of the samples were then treated with terminator exonuclease (TEX ...
-
bioRxiv - Microbiology 2021Quote: ... or beads alone were suspended in 1x NEBuffer™ for Protein Kinases with 200μM ATP (Thermo) and 100 units of CK2 (NEB) at 30°C for 45 minutes ...
-
bioRxiv - Microbiology 2021Quote: Protein bound glutathione Sepharose beads were resuspended in 1x NEBuffer™ for Protein Kinases supplemented with 1mM ATPγS and 10 units of CK2 (NEB) and incubated at 30°C for 45 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... RJ-167-mer and RJ-5’Tail-167mer were radiolabeled with 32P at the 5′-end using T4 Polynucleotide Kinase (NEB). To generate the 3′ Tail and dsDNA DNA substrates ...
-
bioRxiv - Molecular Biology 2022Quote: ... the sRNA fraction (∼15- 35nt) was isolated by gel extraction and RNA species bearing 5’-OH were monophosphorylated by T4 polynucletide kinase (NEB). This was followed by treatment by a terminator exonuclease (Epicentre) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-protein complexes were radioactively labeled with 32P-γ-ATP (20 μCi) using 40U T4 Polynucleotide Kinase (New England Biolabs) in supplied PNK buffer for 30 min at 37ºC ...
-
bioRxiv - Biochemistry 2022Quote: ... 5’-phosphorylated DNA guides were either purchased from Integrated DNA technologies or generated by incubating an unmodified oligonucleotide with T4 Polynucleotide Kinase (NEB) at 37 °C for 30 minutes ...
-
bioRxiv - Biophysics 2022Quote: Open complexes were pre-formed by incubating an excess of RNAP holoenzyme (>1.7 nM active) with <400 pM γ-32P-labeled promoter DNA (labeled with T4 polynucleotide kinase from NEB) in BB at 37 °C for at least 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: Gene-specific primers (Supplementary Table 4) were labeled with [γ-32P]ATP by phage T4 polynucleotide kinase (New England Biolabs), as recommended by the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... GST aPKC PBM and his aPKC kinase domain-PBM (residues 259-606) were cloned as previously described (10) using Gibson cloning (New England BioLabs), Q5 mutagenesis (New England BioLabs ...
-
bioRxiv - Biochemistry 2019Quote: ... 10 pmol of oligonucleotide was labeled at the 5’ terminus with 0.05 mCi [γ-32P]-ATP using T4 Polynucleotide Kinase (New England Biolabs). For annealing ...
-
bioRxiv - Biochemistry 2019Quote: ... GST fusion proteins of the CTD and its mutants CTD-AA and CTD-YA were phosphorylated by Cdc2 kinase (NEB) using 32P-γ-ATP for 30 minutes at 30°C before incubated with immunoprecipitated CoAA or hnRNP M ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 20picomoles of CIP treated RNA was 5’ end labeled with 50μCi of [γ-32P] ATP (10mCi/ mL, BRIT, India) by incubating with T4 polynucleotide kinase (New England Biolabs) at 37°C for 35 min ...
-
bioRxiv - Cell Biology 2020Quote: ... The kinase-inactive mutant was generated by a two-step PCR method using the Phusion High-fidelity kit (New England Biolabs). In the first step ...
-
bioRxiv - Molecular Biology 2020Quote: ... tRF-5s, itRFs were end-labeled with 32P-ATP (Board of Radiation and Isotope Technology, India) using polynucleotide kinase (NEB), purified through MicroSpin G-25 Columns (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ ends of ds-probes were radioactively labelled with [ψ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs), purified on Illustra Microspin G-25 columns (GE) ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was then supplemented with 5 mM DTT and the same concentrations of T4 polynucleotide kinase (New England BioLabs) and [γ-32P]-ATP (PerkinElmer ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA (50 pmol) was radiolabelled at 5′ end with by using 10 units of T4 polynucleotide kinase (New England Biolabs) mixed to 3 μl of γ32P-ATP (3000 Ci/mmol 10 mCi/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... Oligos including 20 bp sgRNA sequences plus appropriate overhangs were resuspended in ddH2O at 100 μM and annealed in T4 ligase buffer with T4 polynucleotide kinase (both NEW ENGLAND BIOLABS) starting from 95 °C for 5 minutes and then temperature was ramped down to 25 °C at 5 °C/min ...
-
bioRxiv - Microbiology 2022Quote: ... Radioactive probe was prepared using 40 pmol of primer 59 and 5’-labelled with 10 U of T4 Polynucleotide Kinase (New England Biolabs) and [γ32P]ATP (150 μCi) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pDONR223-SGK used as a template to generate the myr SGK1 construct as well as SGK1 kinase dead (K127M) constructs using Site-Directed Mutagenesis (New England Biolabs). SGK1 was mutated with the following primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA was then end-repaired with 20 U of 3’-phosphatase-positive bacteriophage T4 polynucleotide kinase (T4 PNK; New England Biolabs), using conditions recommended by the supplier (1× PNK buffer without ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...
-
bioRxiv - Cell Biology 2022Quote: ... The 3′ end of the fragmented RNA was dephosphorylated with T4 polynucleotide kinase (PNK, New England Biolabs, Ipswich, MA, USA) followed by heat-inactivation ...
-
bioRxiv - Microbiology 2022Quote: ... The purified fragments were then 5’ phosphorylated in a 50 μL reaction containing 10 U of T4 polynucleotide kinase (NEB) and cleaned up through the Monarch PCR & DNA Cleanup spin columns (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... were manipulated in a final volume of 20 μL labeling mixture containing 1X T4 polynucleotide kinase (PNK) enzyme buffer (NEB), milli-Q water ...
-
bioRxiv - Cell Biology 2023Quote: ... Forward and reverse primers for each sgRNA were annealed by pre-incubation at 37°C for 30 minutes with T4 polynucleotide kinase (PNK; NEB), followed by incubation at 95°C for 5 minutes and then ramp down to 25°C at 5°C/min ...
-
bioRxiv - Bioengineering 2023Quote: ... the 5’ end of each oligonucleotide to be ligated was phosphorylated using T4 Polynucleotide Kinase (T4PNK) (New England Biolabs: M0201) at 1 U/25 pmol ends incubated at 37 °C for 90 minutes followed by a 65 °C heat shock for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... and oligonucleotides crp500F and crp500R (one of which was labeled with [γ32P]ATP by use of T4 polynucleotide kinase (NEB)) ...
-
bioRxiv - Systems Biology 2023Quote: ... 3’ ends of RNA were modified to have 3’ OH groups compatible for ligation using T4 Polynucleotide Kinase (NEB, #M0201L). Beads were incubated at 37°C for 10 minutes with shaking at 1200 rpm on a ThermoMixer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We then extracted the RNA from the monosomes with a standard phenol/chloroform protocol and dephosphorylated the RNA by T4 polynucleotide kinase (New England Biolabs). We specifically excised RNAs spanning 28-34nt from the gel ...
-
bioRxiv - Biochemistry 2023Quote: Both native and modified oligonucleotides were 5’-32P labeled by [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs) following manufactures recommendations ...
-
bioRxiv - Biophysics 2023Quote: Oligonucleotides used as substrates in D-loop assays were radiolabelled at their 5′-end using T4 Polynucleotide Kinase (T4 PNK - NEB) and adenosine triphosphate [γ-32P] (Perkin Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... Equimolar amounts of complementary oligonucleotides were phosphorylated by incubation with T4 polynucleotide kinase in T4 ligation buffer (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: 32P-labelled DNA fragments were generated by PCR using primers labelled with [γ-32P]ATP using T4 polynucleotide kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The radioactive probe was prepared from 40 pmoles of primers described in Supplementary Table 7 and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ- 32P]-ATP (150 µCi) ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Bioengineering 2023Quote: ... for the ligation rounds are added to 96 well plates and their 5’ ends phosphorylated with T4 Polynucleotide Kinase (NEB). After 5’ phosphorylation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Oligos (20 pmoles) were labeled at their 5’ ends using gamma-32P-rATP (3000 Ci/mmole) and polynucleotide kinase (New England Biolabs), and purified on 7M urea ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Table S4) were hybridised by slow cooling down from 95-25°C and then phosphorylated using the T4 Polynucleotide Kinase (NEB). The digested plasmid and the hybridised oligonucleotides were ligated using the T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant MBP-Megator fragments were purified with amylose magnetic beads (New England Biolabs) and eluted in Column Buffer supplemented with 10mM Maltose ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were affinity-purified using amylose resin using the manufacturer’s protocol (NEB) and eluted with 20 mM maltose ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15μL of myc-eIF6-bound beads were incubated with/without recombinant GSK3β (NEB) and suspended in cold kinase buffer and incubated at 30°C for 30 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM CaCl2) at room temperature in the presence of recombinant enteropeptidase (NEB) at 13 U enzyme per mg TMPRSS2 zymogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant protein was sequentially purified using an amylose column (New England Biolabs) followed by a nickel-nitrilotriacetic acid column (Qiagen ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Genomics 2024Quote: ... 200 µg/mL molecular biology grade recombinant albumin (rAlbumin) (New England Biolabs B9200S), 0.8 U/µL RiboLock RNase inhibitor (Thermo Fisher Scientific EO0384) ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...