Labshake search
Citations for New England Biolabs :
201 - 250 of 8855 citations for Soluble Starch Synthase Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: RNase III assay: 1 μg double-stranded (ds) RNA substrates were digested with either ShortCut® RNase III (NEB) or RNase III (6xHis ...
-
bioRxiv - Microbiology 2022Quote: ... a product flanking the sgRNA target sites was PCR-amplified and subjected to a T7 Endonuclease I assay (NEB) to detect indels ...
-
bioRxiv - Microbiology 2022Quote: ... Conventional PCR assays were carried out with Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Australia). For some samples ...
-
bioRxiv - Genetics 2023Quote: ... and F2 crispants were fin clipped at 5 weeks and genotyped by a T7EI assay (M0302, New England Biolabs). We extracted DNA using the Quick-DNA Microprep Kit (D3021 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The sgRNA target region was amplified from transfected cells and analyzed by T7 endo1 nuclease assay (New England Biolabs). sgRNA ...
-
Mechanism of RanGTP priming H2A-H2B release from Kap114 in an atypical RanGTP•Kap114•H2A-H2B complexbioRxiv - Biochemistry 2023Quote: Pull-down binding assays were performed by immobilizing purified His6MBP or His6MBP-Kap114 on amylose resin (New England BioLabs). Resin was stored in Binding Assay (BA ...
-
bioRxiv - Molecular Biology 2023Quote: LAMP assays were developed with the Warm Start Colorimetric LAMP 2X Master Mix (DNA & RNA) (New England Biolabs, USA), using a mixture of LAMP oligonucleotides at a final concentration of 1.6 μM FIP and BIP ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA molecules were purified using a commercially available purification kit (MonarchQR Plasmid Miniprep Kit, NEB). The purified plasmids were run on a 0.8% agarose gel supplemented with 2.5 µg/mL of chloroquine in 1xTBE buffer containing 2.5 µg/mL of chloroquine at 25 V for 15 hours ...
-
bioRxiv - Plant Biology 2020Quote: ... using the Gibson assembly kit (NEB). The pET28b vector was linearized by digesting with BamHI and XhoI to create overhangs compatible for Gibson assembly ...
-
bioRxiv - Biophysics 2020Quote: Using PURExpress kits (New England Biolabs), 37.5 μL IVT reactions were assembled on ice with 1.5 μl RNase inhibitor ...
-
bioRxiv - Microbiology 2020Quote: ... using the NEBuilder HiFi kit (NEB).
-
bioRxiv - Microbiology 2020Quote: ... using the NEBuilder HiFi kit (NEB). The mdtU-lacZ translational fusions were constructed by PCR-amplifying the mdtU gene from either a WT (E ...
-
bioRxiv - Molecular Biology 2022Quote: ... NEBNext rRNA Depletion kit( NEB #E7405) was used to deplete ribosomal RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... USA (NEB PCR Cloning Kit E1203S) were used for the sub-cloning of DNA fragments and to create plasmid templates for run-off in vitro transcription ...
-
bioRxiv - Cell Biology 2019Quote: ... using Gibson assembly cloning kit (NEB). COX8A-SNAP vector was commercially obtained from NEB ...
-
bioRxiv - Genomics 2021Quote: ... NEBNext UltraII Q5 kit (NEB M0544) was used for PCR enrichment ...
-
bioRxiv - Microbiology 2021Quote: ... using Monarch Plasmid Miniprep kit (NEB). Sequencing was through the company Genewiz.
-
bioRxiv - Molecular Biology 2021Quote: ... Q5 Site-Directed Mutagenesis Kit (NEB) was used for generating dCas9 plasmids encoding the mutant p300core* (Y1467F ...
-
bioRxiv - Immunology 2022Quote: ... The second strand synthesis kit (NEB) at 16°C for 2 hours was used for cDNA synthesis followed by a 1.4X AMPure XP bead cleanup ...
-
bioRxiv - Cell Biology 2022Quote: ... Q5 site directed mutagenesis kit (NEB) was used and the manufacturer’s instructions were followed.
-
bioRxiv - Biophysics 2020Quote: ... and Q5 Hotstart Mutatagenesis kit (NEB) were used.
-
bioRxiv - Genomics 2022Quote: Monarch Genomic DNA Purification kit (NEB)
-
bioRxiv - Developmental Biology 2022Quote: ... “Q5 Site-Directed Mutagenesis Kit” (NEB) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... using the Gibson assembly kit (NEB) to create pBPGUw-QF2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... HiScribe T7 ARCA mRNA kit (NEB) was used for mRNA synthesis with 10 μl of 2x ARCA/NTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... or Monarch RNA isolation kit (NEB) was used for RNA extraction ...
-
bioRxiv - Immunology 2021Quote: ... end blunting (Quick blunting kit; NEB), and ligation with (T4 ligase ...
-
bioRxiv - Neuroscience 2021Quote: ... NEBNext rRNA Depletion Kit (NEB E6310) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... Monarch RNA cleanup kit (T2030L, NEB), Murine RNase inhibitor (M0314L ...
-
bioRxiv - Biophysics 2022Quote: ... using a Gibson Assembly kit (NEB). Full-length Cav1.2 or Cav1.2(ΔC ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted by NEB PCR Cleanup Kit (NEB Cat. # T1030), followed by quality control steps using Qubit fluorometer and bioanalyzer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The NEBNext Library Quant kit (NEB) was used to quantify the amplicons prior to pooling ...
-
bioRxiv - Cancer Biology 2022Quote: ... Using LunaScript RT Supermix kit (BioLabs), cDNA was prepared in a 20 μL reaction according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: Site-Directed Mutagenesis Kit (NEB E0554). Following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Monarch® RNA Cleanup Kit (NEB) was used to purify RNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... The NEBNext rRNA depletion kit (NEB) was used to deplete ribosomal RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEB Miniprep Kits (NEB, T1010).
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Q5 Site-Directed Mutagenesis Kit (NEB) was used according to manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The Monarch RNA Cleanup Kit (NEB) was used to purify the resulting RNA ...
-
bioRxiv - Synthetic Biology 2023Quote: Monarch DNA Gel Extraction kit (NEB), for purifying PCR products products prior to assembly (Note ...
-
bioRxiv - Molecular Biology 2024Quote: ... Q5 site directed mutagenesis kit (NEB) was used to generate various SARS-CoV-2 FSE conformation stabilizing constructs and other length dependent constructs and their sequences were confirmed through sanger sequencing (Eurofins genomics) ...
-
bioRxiv - Cell Biology 2024Quote: ... using the HiFi Assembly kit (NEB). NEBuilder Assembly Tool 2.0 was used to design RRM1-2 primers with 21-bp overlap with the destination vector ...
-
bioRxiv - Immunology 2024Quote: ... The NEBNextII kit (New England Biolabs) was used to prepare the sequencing library ...
-
bioRxiv - Biophysics 2021Quote: The DNA substrate used in the optical trapping assay was a ~3400-bp PCR-amplified section of plasmid PBR322 (New England Biolabs). The forward primer (5’-/btn/-ACA GCA TCG CCA GTC ACT AT-3’ ...
-
bioRxiv - Biophysics 2021Quote: The assembly of GRB2 SH3 and PSD95 PDZ mutant libraries in both assay plasmids were done overnight by temperature-cycle ligation using T4 ligase (New England Biolabs) according to the manufacturer's protocol ...
-
bioRxiv - Genetics 2021Quote: ... The mutagenesis of target sites was confirmed in a subset of somatic mosaics using a T7 endonuclease assay (NEB, UK).
-
bioRxiv - Molecular Biology 2021Quote: LAMP assay was performed in a total volume of 25 μl with Bst 2.0 WarmStart™ DNA Polymerase (New England Biolabs). The reagents ...
-
bioRxiv - Immunology 2021Quote: The DNA sequences of B.1.351 and B.1.617 SARS-CoV-2 spikes for the mRNA transcription and pseudovirus assay were synthesized as gBlocks (IDT) and cloned by Gibson Assembly (NEB) into pcDNA3.1 plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... The subsequent CRISPR detection was performed by adding 8.75 μL of CRISPR Mix (1X TtCmr Activity Assay Buffer, ~62.5 nM TtCmr complex, 500 nM TTHB144, 2 μL NTP Buffer Mix (NEB #E2050), 25 U Hi-T7 RNA polymerase (NEB #M0658) ...
-
bioRxiv - Neuroscience 2022Quote: ... were designed using the CCTop target online predictor (Stemmer et al, 2015) and cutting efficiency was evaluated by T7EI Assay using T7 Endonuclease I (NEB). We selected the TSC2Ex2-gRNA (TGTTGGGATTGGGAACATCGAGG ...