Labshake search
Citations for New England Biolabs :
401 - 450 of 3546 citations for Recombinant Mouse Frizzled Homolog 1 Drosophila His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... Site-directed mutagenesis was performed to change Arg106 to a histidine (His) using Q5® Site-Directed Mutagenesis Kit (New England Biolabs Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library for Illumina sequencing was prepped using the NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The purified fragments and the pABC3-His or pABC3-GFP vector were digested with PacI and NotI restriction enzymes (New England Biolabs, MA, USA). Resultant fragments were then gel-purified using the Monarch DNA Gel extraction kit (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepped by NEBNext Ultra II DNA library Prep Kit for Illumina (NEB Cat# E7645S) according to the manufacturers’ instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Singh et al 2014) were synthesized (Integrated DNA Technologies, Research Triangle Park, NC) and assembled by Hi-Fi assembly (New England Biolabs, Ipswich, MA) into a modified pCAMBIA0380 expression construct (Genbank AF234290.1 ...
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Miip CDS was amplified by PCR and cloned into LV17 (EF-1α-Luciferase-puro) shuttle vector (GenePharma, Shanghai, China) with restriction enzymes Not I and Bam HI (New England Biolabs, Ipswich, MA). For mouse Miip specific knock-down ...
-
bioRxiv - Biochemistry 2024Quote: ... Digestion was set up to remove the 6X-His-tag by incubating with either homemade or store bought (NEB, Cat. no: P8070L) enterokinase in the presence of 10mM CaCl2 at 22°C for 16h ...
-
bioRxiv - Molecular Biology 2019Quote: ... After annealing the complex an equimolar amount was mixed with 1000ng Cas9 recombinant protein (NEB; final conc 20ng/ul) and incubated at RT for 15’ ...
-
bioRxiv - Genetics 2019Quote: P2C-Cas9 and P2C-EGFP proteins were expressed from pET28a-P2C-Cas9 and pRSET-P2C-EGFP respectively by recombinant BL21 E.coli (NEB) as described in detail in Chaverra-Rodriguez et al ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 μg each of the recombinant proteins were lyophilized and digested with PNGase F (P0701S, New England Biolabs Inc.) according to the manufacture’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... were used to amplify the pQE60- ompA recombinant plasmid (Size- 4.5 kb) using Phusion high fidelity DNA polymerase (NEB). The reaction mixture was heated at 950C for 10 minutes for the plasmid’s denaturation ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL purified supernatant were combined with 2,500 units recombinant glycerol-free PNGase F and Glycobuffer 2 (New England Biolabs) following the manufacturer’s protocol for non-denaturing digestion and incubated at 37°C for 5 hours ...
-
bioRxiv - Genetics 2022Quote: ... Eggs were then injected under air-dry conditions with a solution containing 300ng/μl of recombinant Cas9 Nuclease (NEB) and 100ng/ul each of four sgRNAs targeting the first exon of the Oatp74D gene (S2 Table) ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant plasmids encoding a catalytically inactive 3Dpol (3Dneg) were generated using the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). Nucleotides at position 6891 and 6892 of the CVB3/28 genome were mutated from AT to GC ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were pelleted at 500 x g for 5 minutes and resuspended in 8µg/mL recombinant albumin (New England Biolabs) in dPBS-/- ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature before being incubated with 1.0 µg/mL of recombinant human histone H3.1 (New England Biolabs, #M2503S) for 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Immunology 2021Quote: Restriction digest of pEX-K4 plasmid DNA containing EtAMA1Cit or was performed using Bam HI and Xho I (New England Biolabs, Ipswich, MA, USA) to extract tagged antigen coding sequences for cloning into pYD1 plasmid vector ...
-
bioRxiv - Biochemistry 2024Quote: N-term-His-ELMO1C438A construct was generated from N-term-His-ELMO1 construct obtained above using Q5® Site-Directed Mutagenesis Kit (New England BioLabs, cat # E0554S), with the following primers.
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Immunology 2020Quote: ... was inserted into a published oligonucleotide scaffold (Talbot and Amacher, 2014) and injected together with recombinant Cas9 protein (New England Biolabs) into 1-2 cell stage zebrafish (AB strain) ...
-
bioRxiv - Microbiology 2020Quote: Template DNA was amplified by PCR using custom DNA primers (Table S3) and recombinant Phusion Hot Start polymerase (New England Biolabs). In vitro transcription was carried out in a volume of 2.5 mL comprising 1.0 mL of PCR reaction as template ...
-
bioRxiv - Genomics 2021Quote: 1 µg of genomic DNA (nuclear + mitochondrial DNA) per 50 µl reactions was digested with 40 units of the recombinant restriction enzyme BamHI-HF (NEB) for 1 hour at 37°C in the presence of CutSmart buffer (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... All the point mutations in the recombinant LC3B and GABARAP were generated by Q5 Site-Directed Mutagenesis Kit (New England BioLabs). pGEX-6P1-GST-ATG3 was a gift from Dr ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... coli C2523 pMAL-c5X vector and recombinant MUP (rMUP) was made using pMAL Protein Fusion and Purification System (New England Biolabs) using methods similar to prior studies27,36 ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...
-
bioRxiv - Molecular Biology 2019Quote: 10 pmol of either RNA I or RNA A was incubated in the presence or absence of both Mg2+ at a 10 mM final concentration and/or 9pmol recombinant eEndoV (New England Biolabs) in a total volume of 10 μL ...
-
bioRxiv - Developmental Biology 2019Quote: ... The recombinant DBINO domain containing protein (~80kDa) was purified using the amylose affinity column (New England Biolabs, Massachusetts, United States) and detected using the anti-MBP-HRP antibody (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein expression was induced with 0.3 mM IPTG for 2 hours at 37°C and recombinant MBP-rabaptin5 was purified with an amylose resin (New England Biolabs) according to manufacturs instructions and dialysed against lysis buffer (20 mM Tris-HCl ph7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... The linearized vector and geneblock were then mixed to create the dsTE12Q.HA-Capsid recombinant SINV vector using NEBuilder® HiFi DNA Assembly Master Mix per manufacturer’s instructions (New England BioLabs, E2621S). The mutant herpes simplex virus type 1 (HSV-1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A CRISPR array containing two repeats and one spacer targeting the gfp gene of recombinant Sindbis virus (SINV-GFP) was generated by annealing and extending two partially complementary DNA oligos with Q5 polymerase (NEB) (Table S1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... When needed the mRNA was polyadenylated after transcription using a recombinant poly-A polymerase as recommended by the manufacturer (NEB Biolabs).
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1× CutSmart buffer (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, 100 µg/ml BSA or recombinant albumin; NEB), 0.5 mM 1,4-Dithiothreitol (DTT) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 200 μM each of dATP/dCTP/dTTP at 21°C for 10 min and an additional 15 min incubation with 25 nM recombinant human RPA (a gift from Sarah W. Cai) and 0.03 U/μl T4 DNA polymerase (NEB, #M0203) at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... dsRNA was synthesized from T7-linked DNA using the HI Scribe™ T7 High Yield RNA Synthesis Kit (New England, Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified PCR products were ligated into the recombinant plasmid pZE0-P-MglE-T using the recommended standard USER cloning protocol (NEB, UK).
-
bioRxiv - Developmental Biology 2021Quote: ... After annealing the complex an equimolar amount was mixed with 1000 ng Cas9 recombinant protein (NEB; final concentration 20 ng/μL) and incubated at RT for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: Phase separation of purified recombinant Cdc15-IDR-SH3 co-expressed with Pom1 was induced by treatment with α-phosphatase (NEB; P0753L) and dilution to physiological salt concentrations (50 mM Tris pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Neuroscience 2022Quote: All anti-tau monoclonal antibodies were generated by the hybridoma approach against recombinant tau aggregates (human full-length tau) encapsulated in the ACM Polymersomes (ACM Biolabs, Singapore) and purified by size exclusion chromatography (SEC ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant cohesinWT or cohesin3D (25 nM) were incubated with 50 nM NIPBL-MAU2 and 10 ng/μl λ-DNA (NEB, N3011S) in ATP reaction buffer consisting of 20 mM NaH2PO4/Na2HPO4 pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... When needed the mRNA was polyadenylated after transcription using a recombinant poly-A polymerase as recommended by the manufacturer (NEB Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... All recombinant plasmids in this study were constructed with NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts, USA). All oligonucleotides were ordered and all sequencing works were done at Eurofins Genomics (Ebersberg ...