Labshake search
Citations for New England Biolabs :
201 - 250 of 2232 citations for Rat TMEM165 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Positive clones were used for plasmid miniprep (NEB) and verified by sanger sequencing ...
-
bioRxiv - Synthetic Biology 2023Quote: ... miniprepped (Monarch Plasmid Miniprep Kit, New England Biolabs), and transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids were linearized by SacII or SpeI (NEB) restriction enzyme digestion to generate an antisense template ...
-
bioRxiv - Cell Biology 2023Quote: ... The template plasmid was digested with DpnI (NEB), and the PCR amplicon was purified using the DNA Clean & Concentrator-5 (Zymo Research ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified plasmid DNA was linearized with AscI (NEB). Barcodes were amplified with 25 cycles of PCR using the entire sample of extracted DNA from each cell population to ensure complete sequencing coverage ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplified plasmids were digested with DpnI (NEB, R0176). The mCherry coding sequence was amplified with a forward primer located at the mCherry start codon that was tagged with citrine vector homology ...
-
bioRxiv - Biophysics 2024Quote: ... The plasmid was cleaved by XhoI (NEB, #R0146) and NotI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: DNA plasmids were generated using Gibson Assembly (NEB). The unc-54 promoter and unc-54 3’-UTR sequences were amplified from C ...
-
bioRxiv - Molecular Biology 2024Quote: ... to the linearized pAVA plasmid [DPN1 (NEB R0176) and rSAP (NEB M0371 ...
-
bioRxiv - Microbiology 2024Quote: ... the plasmid was linearised with BsaI (NEB,UK). Linearize product was visualized by electrophoresis in 1% agarose gels and then purified from agarose gel ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were amplified using -inverse PCR (Q5, NEB), using primers with overhangs containing spacer sequences ...
-
bioRxiv - Biochemistry 2024Quote: ... and parent plasmids were degraded by DpnI (NEB). All plasmids were transformed into DH5α cells.
-
bioRxiv - Cancer Biology 2024Quote: ... The plasmid was digested with AgeI (NEB #R3552) and EcoRI (NEB #R3101L ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plasmid was digested with BbsI (NEB R3539L) at 37°c overnight and purified with 1.0x AmPure Bead ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid backbone DNA was treated with DpnI (NEB) to remove PCR template DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Systems Biology 2020Quote: ... Plasmids were constructed by gap repair either through in vivo recombination or the NEBuilder plasmid assembly tool (New England Biolabs, USA). Linear products were created by PCR with primers from Sigma Life Science and Q5 Polymerase (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2019Quote: ... plasmids from 120 CFUs with different phenotypes were isolated with the Monarch®Plasmid Miniprep Kit (New England Biolabs, Ipswich, USA) and analyzed via Sanger-sequencing (Eurofins Genomics ...
-
bioRxiv - Bioengineering 2019Quote: ... The linear PCR product was treated with DpnI enzyme to fragmente the template plasmid and self-ligated to generate circular plasmid (Quick Ligation™ Kit, NEB). Promoters containing multiple trpO sequences were constructed by USER cloning from a synthetic DNA fragment (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... EF1α Lamp1-mCherry plasmid was extracted from successful transformants with the Monarch® Plasmid Miniprep Kit (New England BioLabs Inc., USA), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... These fragments were introduced into the previously generated intermediate plasmid (after cutting the plasmid with SpeI [New England Biolabs®, Inc.]) by Gibson assembly to generate the division reporter pUC18-mini-Tn7T-Gm::tetR(BD)-Ptet-mCitrine_mCerulean3-BCD2-P14g.
-
bioRxiv - Biophysics 2021Quote: ... the T7 terminator site was removed from plasmid pIA146 by digesting the plasmid with HindIII and SphI (New England Biolabs, UK). Blunt ends were created using the Klenow fragment of DNA polymerase I (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... Donor sequences which usually contain the upstream and downstream homologous arms of the gene being edited with 21-bp overlap of the XhoI-digested targeting plasmid at each end were amplified by PCR and ligated into the linearized targeting plasmid (digested by XhoI (NEB, USA)) using the ClonExpress II One Step Cloning Kit (Vazyme ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated at 37°C for 18 hours and the plasmid was extracted using the Monarch Plasmid Miniprep Kit (New England Biolabs, US) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmids were constructed by gap repair either through in vivo recombination or the NEBuilder plasmid assembly tool (New England Biolabs, USA). Linear products were created through PCR with primers from Sigma Life Science and Q5 Polymerase (New England Biolabs ...
-
bioRxiv - Biophysics 2023Quote: Plasmid pRS303 CBP-TEV-halo-orc3 gal1-10 orc4 was generated by cloning the CBP-TEV-halo sequence from plasmid pRS306-CBP-TEV-halo-Pri1-Gal1-10 Pri2 into plasmid pRS303-orc3-Gal1-10 orc4 through Gibson assembly (NEB #E2611L) using primers TL-446 ...
-
bioRxiv - Biophysics 2023Quote: ... The R203M N175-245 plasmid was prepared from the WT N175-245 plasmid with site directed mutagenesis (NEB site mutagenesis kit). The plasmids were transformed into BL21(DE3 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Positive colonies were incubated overnight at 37°C and plasmids were isolated using the Monarch Plasmid Miniprep Kit (New England Biolabs, T1010L). For all assembled plasmids the sequence was confirmed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown out in LB medium with 50 µg/mL Kanamycin and then pelleted before plasmids were isolated using the Monarch Plasmid Miniprep Kit (NEB, T1010L). Plasmids were sequenced (Sanger ...
-
bioRxiv - Immunology 2024Quote: ... and the pHW2000 plasmid backbone such that the whole plasmid could be assembled in a one-pot golden gate reaction with PaqCI (NEB, #R0745S). Due to repeated regions ...
-
bioRxiv - Plant Biology 2021Quote: ... was amplified from pDONOR221-GNOMxCS plasmid and cloned into a pre-existing pGII(Bar)-pGNOM:GNOM-YFP plasmid using PspXI (New England Biolabs catalogue no R0656) and MscI (Thermo Scientific catalogue no ER1211 ...
-
bioRxiv - Genetics 2022Quote: ... Strains expressing exogenous Dbp1 from the LEU2 locus were created by cloning the DBP1 ORF as well as ∼1kb of upstream and downstream regulatory sequence into a single integration plasmid targeted to LEU2 This plasmid was linearized by digestion with SwaI nuclease (NEB, Ipswich, MA) and transformed into the dbp1Δ::KANMX6 strain.
-
bioRxiv - Genetics 2022Quote: ... The pBSMVγPDS plasmid and all plasmids expressing BSMV γ chain carrying sgRNAs were linearized with BssHII (New England BioLabs, catalog number R0199S). In vitro transcription was performed in 20 µL reaction volume using HiScribe™ T7 High Yield RNA Synthesis Kit (New England BioLabs ...
-
bioRxiv - Biochemistry 2023Quote: ... was PCR amplified from pDONR221-SUMO2 plasmid (purchased from DNASU plasmid repository, United States) using Phusion® High-Fidelity DNA Polymerase (NEB, USA) with forward primer 5’ GATGGATCCATGGCCGACGAAAAG 3’ and reverse primer 5’ TTCAAGCTTTTAACCTCCCGTCTGCTG 3’ as per the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: 20ug of linearized plasmid with BamHI (New England Biolabs) of which 2ug was transcribed with MEGAscript T3 polymerase (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... the plasmid was digested with NarI and XbaI (NEB), subsequently the ends were blunted with Klenow (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... the plasmid was digested with NotI (New England Biolabs) at 37° C for 16 hours and transfected into the endogenously tagged Cep164C:mNG cell line as previously described ...
-
bioRxiv - Cell Biology 2020Quote: ... The final plasmid was linearized with NotI HF (NEB) prior to transfection ...
-
bioRxiv - Genomics 2020Quote: We digested the resulting plasmid with BseRI (NEB R0581L) and agarose gel-size selected the linearized fragment ...
-
bioRxiv - Genomics 2020Quote: ... we digested the plasmid library with BseRI (NEB R0581L) and agarose gel size-selected the linearized fragment ...
-
bioRxiv - Microbiology 2019Quote: Creation of plasmid was completed through Gibson Assembly (NEB) using a minimum of 20 bp overlapping regions of five DNA fragments following manufacturers protocol ...
-
bioRxiv - Genetics 2020Quote: ... 2μg purified plasmids were digested with KpnI/XbaI (NEB) and ligated with a KpnI/XbaI-digested fragment containing a promoter and reporter gene (EGFP) ...
-
bioRxiv - Genetics 2019Quote: ... plasmid was linearized with BbsI (R3539S, New England Biolabs) and gRNAs were ligated into the restriction site and verified through Sanger sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... plasmid length and gene endonuclease restriction with XbaI (NEB).
-
bioRxiv - Biochemistry 2020Quote: ... the plasmid (10 μg) was completely digested by NEB BsmBI or EarI restriction enzymes (Supp ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 20 units of DpnI (NEB; for removing template plasmid), and 5μl of 10x-CutSmart buffer (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: HDR template plasmids were generated using Gibson Assembly (NEB) cloning ...
-
bioRxiv - Neuroscience 2020Quote: ... Plasmids were transformed into NEB competent cells (NEB C2987I), purified with the NucleoBond Xtra Midi Endotoxin Free kit (Clon-tech 740420.50) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of plasmid was treated with Sssl (NEB) or mock as per the manufacturer’s instructions ...