Labshake search
Citations for New England Biolabs :
551 - 600 of 9852 citations for Rat Heat Shock Protein Beta 8 HSPB8 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Zyagen samples were amplified with PBC096 barcoding for 8-10 cycles with both LongAmp (female, 62°C annealing; NEB, US) and PrimeSTAR GXL (male and female ...
-
bioRxiv - Genomics 2022Quote: Samples were digested by incubation in reverse-crosslinking buffer (50 mM Tris pH 8, 50 mM NaCl, 0.2% SDS) with 1:50 proteinase K (NEB P8107S) for 8-16 hours at 55°C ...
-
bioRxiv - Genomics 2022Quote: ... CRISPEY-BAR barcodes integrated in the genome were amplified with a first step PCR in 8 tubes of 50 uL reactions using Q5 hot-start DNA polymerase (New England Biolabs) following manufacturer recommendations ...
-
bioRxiv - Immunology 2022Quote: ... Iso-Seq libraries were generated using 500 ng high-quality (RIN > 8) RNA as input into oligo-dT primed cDNA synthesis (NEB). Barcoded primers were incorporated into the cDNA during second strand synthesis ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding sequences of ric-8 and nphp-2s were amplified from a mixed-stage N2 cDNA library using Phusion high-fidelity DNA polymerase (NEB) with gene-specific primers and verified by Sanger sequencing.
-
bioRxiv - Genomics 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve cDNAs were then serially diluted ten-fold from 10-1 to 10-8 and run through the SYBR Green assay (New England Biolabs) together with sample cDNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... Each library was dissolved in 100µL Tris 10mM pH 8 and amplified by PCR with specific primers (Fw: GTGAACCGTCAGATCGCCTCGGCACTCCAGTCCT, Rv: AGAGGGTTAGGGATAGGCTTACCTCAGGCTAGTGCGGACCGAGTCG) using NEBNext Ultra II Q5 HotStart (NEB). PCR cycling parameters were set as follows ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... Recombinant Muc1 or lubricin mixed with one of the following enzymes: 8 unit/mL of proteinase K (P8107S, New England Biolabs), 500 μg/mL of pronase (10165921001 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Genomics 2023Quote: ... The resulting digested DNA (4 ml in total) was divided into four aliquots and diluted in 8 ml of ligation buffer (1X ligation buffer NEB without ATP ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genomics 2024Quote: ... Genomic DNA was harvested by discarding culture media and adding lysis buffer consisting of 20 mM Tris pH 8 and 0.1% Triton X-100 (MilliporeSigma T9284) with 60 ng/mL of Proteinase K (New England Biolabs P8107S) added immediately prior to use ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were expressed in BL21 DE3 (New England Biolabs) at 37 °C and 180 rpm after Isipropyl-thiogalactoside (IPTG ...
-
bioRxiv - Molecular Biology 2020Quote: ... lysates were additionally dephosphorylated using Lambda protein phosphatase (NEB) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Then 1.5 ul of 50 μM LbaCas12a protein (NEB) or 1 ul of 63 μM AsCas12a Ultra protein (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were then further purified over amylose resin (NEB) and eluted with elution buffer (20 mM Tris-HCl ...
-
bioRxiv - Developmental Biology 2021Quote: ... The donor DNA (0.6μM) with Cas9 protein (NEB #M0646T), crRNA and tracrRNA were injected in a 1:1:1:1 molar ratio into mouse zygotes by the UCSD Transgenic and Knockout Mouse Core (See Supplementary Table 4 for crRNA sequence) ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein lysates were generated using cell lysis buffer (NEB) and brief sonication on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... We digested the proteins with Proteinase K (NEB #P8107S) for 5 min at 50 °C ...
-
bioRxiv - Pathology 2021Quote: ... and 0.4 μg of T4 gene protein (NEB, M0300S)] ...
-
bioRxiv - Genomics 2021Quote: ... The purified recombinant protein or commercial M.EcoGII (NEB, M0603S) was diluted with coating buffer (0.05 M NaHCO3 buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 9 Neuraminidase A (P0722, NEB, 4 units/µg protein). 10 µg glycoprotein ...
-
bioRxiv - Microbiology 2020Quote: ... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
bioRxiv - Cell Biology 2020Quote: ... against a Color Protein Standard broad range ladder (NEB) in NuPAGE MES SDS buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μL of Lambda Protein Phosphatase (New England Biolabs) or 1 μL of phosphatase inhibitor mix (20 mM β-glycerophosphate ...
-
bioRxiv - Developmental Biology 2021Quote: ... A pre-assembled complex of purified Cas9 protein (NEB) and gRNA was injected and the efficiency of Crispr/Cas9-induced mutagenesis in the F0 generation monitored at 24 hpf using a T7 endonuclease assay (Jao et al. ...
-
bioRxiv - Microbiology 2020Quote: ... RNA-protein complexes were dephosphorylated with T4 PNK (NEB) for 45 minutes in an Eppendorf Thermomixer at 37°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 μM of purified proteins mixed with PEG8000 (NEB) at 10% (w/v ...
-
bioRxiv - Biophysics 2019Quote: ... fusion proteins were directly biotinylated with BG-Biotin (NEB), buffer exchanged with a Zeba Desalting Column (ThermoFisher ...
-
bioRxiv - Plant Biology 2021Quote: ... MBP-MYB6 protein was purified on amylose resin (NEB) and HIS-PUB26 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Protein expression plasmids were cloned using Gibson Assembly (NEB Gibson Assembly Master Mix ...
-
bioRxiv - Synthetic Biology 2020Quote: The protein samples of purified ribosome (New England BioLabs), E ...
-
bioRxiv - Genetics 2020Quote: ... 90 nM of SpCas9 protein (#M0386, New England Biolabs), NEB buffer 3.1 ...
-
bioRxiv - Neuroscience 2020Quote: ... H1 was transfected with pre-assembled Cas9 protein (NEB) + crRNA and tracrRNA (Synthego) ...
-
bioRxiv - Immunology 2021Quote: ... 90 nM of EnGen® Sau Cas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Genetics 2020Quote: ... MEFs were protein transfected with recombinant RNase H (NEB) using Project Reagent Transfection Kit (Thermo ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The supernatants were used with lambda protein phosphatase (NEB) treatment according to its protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... using a commercially available Cas9 protein (New England Biolabs). The efficiency of creating deletion after co-injection of the sgRNA pair was determined by PCR on genomic DNA extracted from injected embryos using the following primers:
-
bioRxiv - Molecular Biology 2022Quote: ... The eluted protein was applied to Amylose resin (NEB) equilibrated with buffer D (20 mM Tris-HCl ...
-
bioRxiv - Microbiology 2022Quote: ... 30 μg of Protein G magnetic beads (NEB #S1430) was washed with 250 μl of Immunoprecipitation Reaction Buffer (150 mM NaCl ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instructions (Lambda protein phosphatase, Biolabs). Western blot analysis was followed with an antibody against GFP (1:1000 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instructions (Lambda protein phosphatase, Biolabs). In parallel ...
-
bioRxiv - Immunology 2023Quote: ... color prestained protein standard (New England Biolabs GmbH, Germany) was included on each gel ...
-
bioRxiv - Bioengineering 2023Quote: ... Tagless protein was expressed in Lemo21(DE3) cells (NEB) in LB (10 g Tryptone ...